Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SdaR - Vibrionales

Properties
Regulator type: Transcription factor
Regulator family: SdaR
Regulation mode: activator
Biological process: Glycerate utilization
Effector: D-glycerate
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Photobacterium profundum SS9 2 1
Vibrio angustum S14
Vibrio cholerae O1 biovar eltor str. N16961 2 1
Vibrio fischeri ES114 2 1
Vibrio harveyi ATCC BAA-1116 1 1
Vibrio parahaemolyticus RIMD 2210633 2 1
Vibrio salmonicida LFI1238 2 1
Vibrio shilonii AK1
Vibrio splendidus LGP32
Vibrio vulnificus CMCP6 2 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
grtP
*
Photobacterium profundum SS9

Site:
position = -171
score = 6.67182
sequence = GATTGTGCAAATGCACAATT

Gene: PBPRA3189: D-glycerate transporter, GntP family
 
Vibrio angustum S14
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -158
score = 6.39229
sequence = AATTGTGCATCTGCACAGTT

Gene: VCA0904: D-glycerate transporter, GntP family
*
Vibrio fischeri ES114

Site:
position = -121
score = 6.61858
sequence = ATTTGTGCAATTGCACAATG

Gene: VF_2156: D-glycerate transporter, GntP family
 
Vibrio harveyi ATCC BAA-1116
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -158
score = 6.83552
sequence = TATTGTGCATTTGCACAATA

Gene: VPA0116: D-glycerate transporter, GntP family
*
Vibrio salmonicida LFI1238

Site:
position = -121
score = 6.02831
sequence = CTTTGTGCATCTACACAATA

Gene: VSAL_I2593: D-glycerate transporter, GntP family
 2
Vibrio shilonii AK1

Gene: VSAK1_09878: D-glycerate transporter, GntP family

Gene: VSAK1_09873: D-glycerate transporter, GntP family
 
Vibrio splendidus LGP32
*
Vibrio vulnificus CMCP6

Site:
position = -129
score = 6.54506
sequence = AATTGTGCAGATGCACAAAA

Gene: VV1_1655: D-glycerate transporter, GntP family
D-glycerate transporter, GntP family
garK
 
Photobacterium profundum SS9

Gene: PBPRA3190: Glycerate kinase (EC 2.7.1.31)
 
Vibrio angustum S14

Gene: VAS14_20011: Glycerate kinase (EC 2.7.1.31)
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VCA0903: Glycerate kinase (EC 2.7.1.31)
 
Vibrio fischeri ES114

Gene: VF_2157: Glycerate kinase (EC 2.7.1.31)
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -144
score = 6.48883
sequence = AATTGTGCAAGTGCACAAAA

Gene: VIBHAR_06863: Glycerate kinase (EC 2.7.1.31)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0117: Glycerate kinase (EC 2.7.1.31)
 
Vibrio salmonicida LFI1238

Gene: VSAL_I2594: Glycerate kinase (EC 2.7.1.31)
 
Vibrio shilonii AK1

Gene: VSAK1_09883: Glycerate kinase (EC 2.7.1.31)
 
Vibrio splendidus LGP32
 
Vibrio vulnificus CMCP6

Gene: VV1_1654: Glycerate kinase (EC 2.7.1.31)
Glycerate kinase (EC 2.7.1.31)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD