Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog TrpR - Shewanellaceae

Properties
Regulator type: Transcription factor
Regulator family: TrpR
Regulation mode: repressor
Biological process: Aromatic amino acid metabolism
Effector: Tryptophan
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 32 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Shewanella oneidensis MR-1 3 2
Shewanella putrefaciens CN-32 3 2
Shewanella sp W3-18-1 3 2
Shewanella sp ANA-3 3 2
Shewanella sp MR-4 3 2
Shewanella sp MR-7 3 2
Shewanella baltica OS155 3 2
Shewanella denitrificans OS217 3 2
Shewanella frigidimarina NCIMB 400 3 2
Shewanella amazonensis SB2B 2 1
Shewanella loihica PV-4 2 1
Shewanella pealeana ATCC 700345 3 2
Shewanella halifaxensis HAW-EB4 3 2
Shewanella piezotolerans WP3 3 2
Shewanella sediminis HAW-EB3 3 2
Shewanella woodyi ATCC 51908 3 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
trpR
*
Shewanella oneidensis MR-1

Site:
position = -32
score = 5.91591
sequence = TGTAATGCTTAAACAATACT

Gene: SO3419: Trp operon repressor
*
Shewanella putrefaciens CN-32

Site:
position = -89
score = 4.96037
sequence = TGTAATGAAGAAGCGTAACA

Site:
position = -32
score = 5.87078
sequence = TGTAATGCTTTAACAGTAGT

Gene: Sputcn32_2737: Trp operon repressor
*
Shewanella sp W3-18-1

Site:
position = -32
score = 5.87078
sequence = TGTAATGCTTTAACAGTAGT

Site:
position = -89
score = 4.96037
sequence = TGTAATGAAGAAGCGTAACA

Gene: Sputw3181_1275: Trp operon repressor
*
Shewanella sp ANA-3

Site:
position = -32
score = 5.91591
sequence = TGTAATGCTTAAACAATACT

Gene: Shewana3_1136: Trp operon repressor
*
Shewanella sp MR-4

Site:
position = -32
score = 5.91591
sequence = TGTAATGCTTAAACAATACT

Gene: Shewmr4_1135: Trp operon repressor
*
Shewanella sp MR-7

Site:
position = -32
score = 5.91591
sequence = TGTAATGCTTAAACAATACT

Gene: Shewmr7_1206: Trp operon repressor
*
Shewanella baltica OS155

Site:
position = -33
score = 5.92992
sequence = TGTAATGCTTGAACAGTACT

Gene: Sbal_1224: Trp operon repressor
*
Shewanella denitrificans OS217

Site:
position = -33
score = 4.80583
sequence = TGTACTGCCATGGCATGACA

Gene: Sden_2743: Trp operon repressor
*
Shewanella frigidimarina NCIMB 400

Site:
position = -35
score = 5.16643
sequence = TGTAATGTCTGGGCATTACT

Gene: Sfri_2909: Trp operon repressor
 
Shewanella amazonensis SB2B

Gene: Sama_0902: Trp operon repressor
 
Shewanella loihica PV-4

Gene: Shew_1076: Trp operon repressor
*
Shewanella pealeana ATCC 700345

Site:
position = -45
score = 5.43512
sequence = TGTAATGACGCACTAGTACG

Gene: Spea_1063: Trp operon repressor
*
Shewanella halifaxensis HAW-EB4

Site:
position = -47
score = 5.10281
sequence = CGTAATGACGCACTAGTACG

Gene: Shal_1111: Trp operon repressor
*
Shewanella piezotolerans WP3

Site:
position = -34
score = 5.45282
sequence = CGTAATGATGCACTAGTACA

Gene: swp_3754: Trp operon repressor
*
Shewanella sediminis HAW-EB3

Site:
position = -31
score = 6.13867
sequence = TGTAATGCTATACCAGTACG

Gene: Ssed_1172: Trp operon repressor
*
Shewanella woodyi ATCC 51908

Site:
position = -81
score = 5.64492
sequence = TGTAATGGAGAGGCAGTACA

Gene: Swoo_1267: Trp operon repressor
Trp operon repressor
 
CRON 2.
aroF
*
Shewanella oneidensis MR-1

Site:
position = -119
score = 6.44418
sequence = TGTAATGGTGTATCATTACG

Gene: SO1361: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Shewanella putrefaciens CN-32

Site:
position = -125
score = 6.45953
sequence = TGTAATGGTGTAGCGTTACA

Gene: Sputcn32_1172: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Shewanella sp W3-18-1

Site:
position = -125
score = 6.45953
sequence = TGTAATGGTGTAGCGTTACA

Gene: Sputw3181_2992: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Shewanella sp ANA-3

Site:
position = -120
score = 6.51188
sequence = TGTAATGGTGTATCATTACA

Gene: Shewana3_3013: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Shewanella sp MR-4

Site:
position = -120
score = 6.71087
sequence = TGTAATGGTGTAGCATTACA

Gene: Shewmr4_2834: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Shewanella sp MR-7

Site:
position = -120
score = 6.64316
sequence = TGTAATGGTGTAGCATTACG

Gene: Shewmr7_2916: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Shewanella baltica OS155

Site:
position = -130
score = 6.71087
sequence = TGTAATGGTGTAGCATTACA

Gene: Sbal_1214: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Shewanella denitrificans OS217

Site:
position = -60
score = 6.51188
sequence = TGTAATGGTGTATCATTACA

Gene: Sden_2750: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Shewanella frigidimarina NCIMB 400

Site:
position = -102
score = 6.45953
sequence = TGTAATGGTGTAGCGTTACA

Gene: Sfri_2916: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Shewanella amazonensis SB2B

Site:
position = -104
score = 6.64935
sequence = TGTAATGGTGTAACATTACA

Gene: Sama_0893: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Shewanella loihica PV-4

Site:
position = -65
score = 6.58164
sequence = TGTAATGGTGTACCATTACG

Gene: Shew_1067: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Shewanella pealeana ATCC 700345

Site:
position = -122
score = 6.39801
sequence = TGTAATGGTGTACCGTTACA

Gene: Spea_1053: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Shewanella halifaxensis HAW-EB4

Site:
position = -134
score = 6.3303
sequence = TGTAATGGTGTACCGTTACG

Gene: Shal_1101: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Shewanella piezotolerans WP3

Site:
position = -104
score = 6.56106
sequence = TGTAATGGTGTAGCAGTACG

Gene: swp_3764: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Shewanella sediminis HAW-EB3

Site:
position = -96
score = 6.56106
sequence = TGTAATGGTGTAGCAGTACG

Gene: Ssed_1163: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Shewanella woodyi ATCC 51908

Site:
position = -106
score = 6.71087
sequence = TGTAATGGTGTAGCATTACA

Gene: Swoo_1258: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
tyrA
 
Shewanella oneidensis MR-1

Gene: SO1362: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1173: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
Shewanella sp W3-18-1

Gene: Sputw3181_2991: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
Shewanella sp ANA-3

Gene: Shewana3_3012: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
Shewanella sp MR-4

Gene: Shewmr4_2833: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
Shewanella sp MR-7

Gene: Shewmr7_2915: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
Shewanella baltica OS155

Gene: Sbal_1215: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
Shewanella denitrificans OS217

Gene: Sden_2749: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2915: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
Shewanella amazonensis SB2B

Gene: Sama_0894: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
Shewanella loihica PV-4

Gene: Shew_1068: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
Shewanella pealeana ATCC 700345

Gene: Spea_1054: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_1102: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
Shewanella piezotolerans WP3

Gene: swp_3763: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1164: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_1259: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD