Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Zur - Listeriaceae

Properties
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 24 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Listeria innocua Clip11262 8 4
Listeria monocytogenes EGD-e 8 4
Listeria seeligeri serovar 1/2b str. SLCC3954 8 4
Listeria welshimeri serovar 6b str. SLCC5334 8 4
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
znuA2
*
Listeria innocua Clip11262

Site:
position = -37
score = 5.28048
sequence = TAAACAAGAACAATTTCGATTTA

Site:
position = -69
score = 5.90257
sequence = TAAATCGTAATTGCTACGATTAG

Gene: lin1779: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Listeria monocytogenes EGD-e

Site:
position = -69
score = 5.60961
sequence = TAAATCGTAATTGCTACGATTCG

Site:
position = -37
score = 5.64944
sequence = TAAACAAGAATTATTTCGATTTA

Gene: lmo1671: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Listeria seeligeri serovar 1/2b str. SLCC3954

Site:
position = -37
score = 5.28048
sequence = TAAACAAGAACAATTTCGATTTA

Site:
position = -69
score = 6.08523
sequence = TAAATCGTAATTACTACGATTGG

Gene: lse_1639: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Listeria welshimeri serovar 6b str. SLCC5334

Site:
position = -37
score = 5.64944
sequence = TAAACAAGAATAATTTCGATTTA

Site:
position = -69
score = 5.90257
sequence = TAAATCGTAATTGCTACGATTAG

Gene: lwe1689: Zinc ABC transporter, periplasmic-binding protein ZnuA
Zinc ABC transporter, periplasmic-binding protein ZnuA
 
CRON 2.
rpsN2
*
Listeria innocua Clip11262

Site:
position = -38
score = 6.26775
sequence = TAAATCGGAATGATTATTATTTA

Gene: lin1995: SSU ribosomal protein S14p
*
Listeria monocytogenes EGD-e

Site:
position = -39
score = 6.26775
sequence = TAAATCGGAATGATTATTATTTA

Gene: lmo1882: SSU ribosomal protein S14p
*
Listeria seeligeri serovar 1/2b str. SLCC3954

Site:
position = -38
score = 6.48446
sequence = TAAATCGGAATTATTACTATTTA

Gene: lse_1865: SSU ribosomal protein S14p
*
Listeria welshimeri serovar 6b str. SLCC5334

Site:
position = -39
score = 6.26775
sequence = TAAATCGGAATGATTATTATTTA

Gene: lwe1901: SSU ribosomal protein S14p
SSU ribosomal protein S14p
 
CRON 3.
znuA
*
Listeria innocua Clip11262

Site:
position = -34
score = 6.11825
sequence = TAAATCGTAATCATTACGAAAAA

Site:
position = -97
score = 5.86313
sequence = CAAATAAGAATGATTACGTTTTA

Gene: lin0191: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Listeria monocytogenes EGD-e

Site:
position = -97
score = 5.75329
sequence = CAAATAAGAATTATTACGTTTTG

Site:
position = -34
score = 6.11825
sequence = TAAATCGTAATCATTACGAAAAA

Gene: lmo0153: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Listeria seeligeri serovar 1/2b str. SLCC3954

Site:
position = -96
score = 5.73932
sequence = CAAATAAGAATGATTACGTTTTG

Site:
position = -32
score = 5.99444
sequence = TAAATCGTAATCATTACGAAAAG

Gene: lse_0133: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Listeria welshimeri serovar 6b str. SLCC5334

Site:
position = -97
score = 5.73932
sequence = CAAATAAGAATGATTACGTTTTG

Site:
position = -34
score = 6.11825
sequence = TAAATCGTAATCATTACGAAAAA

Gene: lwe0129: Zinc ABC transporter, periplasmic-binding protein ZnuA
Zinc ABC transporter, periplasmic-binding protein ZnuA
znuC
 
Listeria innocua Clip11262

Gene: lin0192: Zinc ABC transporter, ATP-binding protein ZnuC
 
Listeria monocytogenes EGD-e

Gene: lmo0154: Zinc ABC transporter, ATP-binding protein ZnuC
 
Listeria seeligeri serovar 1/2b str. SLCC3954

Gene: lse_0134: Zinc ABC transporter, ATP-binding protein ZnuC
 
Listeria welshimeri serovar 6b str. SLCC5334

Gene: lwe0130: Zinc ABC transporter, ATP-binding protein ZnuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
 
Listeria innocua Clip11262

Gene: lin0193: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Listeria monocytogenes EGD-e

Gene: lmo0155: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Listeria seeligeri serovar 1/2b str. SLCC3954

Gene: lse_0135: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Listeria welshimeri serovar 6b str. SLCC5334

Gene: lwe0131: Zinc ABC transporter, inner membrane permease protein ZnuB
Zinc ABC transporter, inner membrane permease protein ZnuB
 
CRON 4.
znuC2
*
Listeria innocua Clip11262

Site:
position = -89
score = 6.2221
sequence = TAATTCGAAGTAATTACGATTTA

Gene: lin1485: Zinc ABC transporter, ATP-binding protein ZnuC
*
Listeria monocytogenes EGD-e

Site:
position = -89
score = 6.2221
sequence = TAATTCGAAGTAATTACGATTTA

Gene: lmo1447: Zinc ABC transporter, ATP-binding protein ZnuC
*
Listeria seeligeri serovar 1/2b str. SLCC3954

Site:
position = -88
score = 6.2221
sequence = TAATTCGAAGTTATTACGATTTA

Gene: lse_1365: Zinc ABC transporter, ATP-binding protein ZnuC
*
Listeria welshimeri serovar 6b str. SLCC5334

Site:
position = -89
score = 6.2221
sequence = TAATTCGAAGTAATTACGATTTA

Gene: lwe1463: Zinc ABC transporter, ATP-binding protein ZnuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB2
 
Listeria innocua Clip11262

Gene: lin1484: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Listeria monocytogenes EGD-e

Gene: lmo1446: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Listeria seeligeri serovar 1/2b str. SLCC3954

Gene: lse_1364: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Listeria welshimeri serovar 6b str. SLCC5334

Gene: lwe1462: Zinc ABC transporter, inner membrane permease protein ZnuB
Zinc ABC transporter, inner membrane permease protein ZnuB
zur
 
Listeria innocua Clip11262

Gene: lin1483: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Listeria monocytogenes EGD-e

Gene: lmo1445: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Listeria seeligeri serovar 1/2b str. SLCC3954

Gene: lse_1363: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Listeria welshimeri serovar 6b str. SLCC5334

Gene: lwe1461: Zinc homeostasis transcriptional regulator Zur, Fur family
Zinc homeostasis transcriptional regulator Zur, Fur family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD