Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog GudR - Comamonadaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Glucarate utilization
Effector:
Phylum: Proteobacteria/Beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 11 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Leptothrix cholodnii SP-6
Methylibium petroleiphilum PM1 3 2
Verminephrobacter eiseniae EF01-2
Delftia acidovorans SPH-1
Acidovorax avenae subsp. citrulli AAC00-1 3 2
Acidovorax sp. JS42
Comamonas testosteroni KF-1
Variovorax paradoxus S110
Rhodoferax ferrireducens DSM 15236
Polaromonas sp. JS666 7 4
Polaromonas naphthalenivorans CJ2 1 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
tctC
 
Leptothrix cholodnii SP-6
 
Methylibium petroleiphilum PM1
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_3406: Tripartite tricarboxylate transporter family receptor, putative transporter for uronates
 
Delftia acidovorans SPH-1
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Variovorax paradoxus S110

Gene: Vapar_5709: Tripartite tricarboxylate transporter family receptor, putative transporter for uronates
 
Rhodoferax ferrireducens DSM 15236
*
Polaromonas sp. JS666

Site:
position = -79
score = 5.88688
sequence = AATTGTTAGCGCTAACATTC

Gene: Bpro_4526: Tripartite tricarboxylate transporter family receptor, putative transporter for uronates
 
Polaromonas naphthalenivorans CJ2
Tripartite tricarboxylate transporter family receptor, putative transporter for uronates
 
CRON 2.
gudR
 
Leptothrix cholodnii SP-6
*
Methylibium petroleiphilum PM1

Site:
position = -36
score = 5.47034
sequence = GGATGGTAGCGGTGTCATCT

Gene: Mpe_A0968: Predicted D-glucarate utilization regulator, LacI family
 
Verminephrobacter eiseniae EF01-2
 
Delftia acidovorans SPH-1
*
Acidovorax avenae subsp. citrulli AAC00-1

Site:
position = -110
score = 5.87948
sequence = GGATGTTAACGTTAACATCC

Gene: Aave_3625: Predicted D-glucarate utilization regulator, LacI family
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Variovorax paradoxus S110
 
Rhodoferax ferrireducens DSM 15236
*2
Polaromonas sp. JS666

Site:
position = -24
score = 4.89221
sequence = GCAAGTTAGCGTTAACATCA

Gene: Bpro_4527: Predicted D-glucarate utilization regulator, LacI family

Site:
position = -33
score = 5.19335
sequence = GACTGGTAGCGCTATCGTCG

Gene: Bpro_3418: Predicted D-glucarate utilization regulator, LacI family
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_1131: Predicted D-glucarate utilization regulator, LacI family
Predicted D-glucarate utilization regulator, LacI family
 
CRON 3.
kdgD
 
Leptothrix cholodnii SP-6
 
Methylibium petroleiphilum PM1
 
Verminephrobacter eiseniae EF01-2
 
Delftia acidovorans SPH-1
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Variovorax paradoxus S110
 
Rhodoferax ferrireducens DSM 15236
*
Polaromonas sp. JS666

Site:
position = -29
score = 5.98784
sequence = AAAAGGTAGCGCTACCATTC

Site:
position = -2
score = 5.50353
sequence = CAATGGTAGCGCTACCTTTA

Gene: Bpro_3419: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
 
Polaromonas naphthalenivorans CJ2
5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
tctC4
 
Leptothrix cholodnii SP-6
*
Methylibium petroleiphilum PM1

Site:
position = -73
score = 5.98784
sequence = GAACGGTAGCGCTACCATTT

Site:
position = -51
score = 4.80949
sequence = AGACGATAGCGCTACCAGAT

Gene: Mpe_A0969: Tripartite tricarboxylate transporter family receptor, putative transporter for uronates
 
Verminephrobacter eiseniae EF01-2
 
Delftia acidovorans SPH-1
*
Acidovorax avenae subsp. citrulli AAC00-1

Site:
position = -40
score = 5.87948
sequence = GGATGTTAACGTTAACATCC

Gene: Aave_3624: Tripartite tricarboxylate transporter family receptor, putative transporter for uronates
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Variovorax paradoxus S110
 
Rhodoferax ferrireducens DSM 15236
 
Polaromonas sp. JS666

Gene: Bpro_3420: Tripartite tricarboxylate transporter family receptor, putative transporter for uronates
 
Polaromonas naphthalenivorans CJ2
Tripartite tricarboxylate transporter family receptor, putative transporter for uronates
gudD
 
Leptothrix cholodnii SP-6
 
Methylibium petroleiphilum PM1

Gene: Mpe_A0970: Glucarate dehydratase (EC 4.2.1.40)
 
Verminephrobacter eiseniae EF01-2
 
Delftia acidovorans SPH-1
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_3623: Glucarate dehydratase (EC 4.2.1.40)
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Variovorax paradoxus S110
 
Rhodoferax ferrireducens DSM 15236
 
Polaromonas sp. JS666

Gene: Bpro_3421: Glucarate dehydratase (EC 4.2.1.40)
*
Polaromonas naphthalenivorans CJ2

Site:
position = -93
score = 5.6931
sequence = AAATGTTACCGATAACATTG

Gene: Pnap_1130: Glucarate dehydratase (EC 4.2.1.40)
Glucarate dehydratase (EC 4.2.1.40)
kgsD
 
Leptothrix cholodnii SP-6
 
Methylibium petroleiphilum PM1
 
Verminephrobacter eiseniae EF01-2
 
Delftia acidovorans SPH-1
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Variovorax paradoxus S110
 
Rhodoferax ferrireducens DSM 15236
 
Polaromonas sp. JS666

Gene: Bpro_3422: Alpha-ketoglutaric semialdehyde dehydrogenase (EC 1.2.1.26)
 
Polaromonas naphthalenivorans CJ2
Alpha-ketoglutaric semialdehyde dehydrogenase (EC 1.2.1.26)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD