Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog QorR - Streptomycetaceae

Properties
Regulator type: Transcription factor
Regulator family: HxlR
Regulation mode: repressor
Biological process: Energy metabolism
Effector:
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Streptomyces coelicolor A3(2) 3 2
Streptomyces avermitilis MA-4680 3 2
Streptomyces griseus subsp. griseus NBRC 13350 3 2
Streptomyces scabiei 87.22 3 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
qorD
*
Streptomyces coelicolor A3(2)

Site:
position = -69
score = 5.23508
sequence = GCACTATCCTCTGGTTAGCGC

Gene: SCO4593: NADPH:quinone oxidoreductase 2, possible protective/detoxification role
*
Streptomyces avermitilis MA-4680

Site:
position = -66
score = 5.96986
sequence = GTACTTTCGCTGAGTTAGTGC

Gene: SAV_4874: NADPH:quinone oxidoreductase 2, possible protective/detoxification role
*
Streptomyces griseus subsp. griseus NBRC 13350

Site:
position = -103
score = 5.76484
sequence = GTACTTTCCCATAGTTAGCGC

Gene: SGR_2932: NADPH:quinone oxidoreductase 2, possible protective/detoxification role
*
Streptomyces scabiei 87.22

Site:
position = -68
score = 5.88905
sequence = GTACTTTCGCAGAGTTAGCGC

Gene: SCAB_37591: NADPH:quinone oxidoreductase 2, possible protective/detoxification role
NADPH:quinone oxidoreductase 2, possible protective/detoxification role
qorB
 
Streptomyces coelicolor A3(2)

Gene: SCO4592: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2)
 
Streptomyces avermitilis MA-4680

Gene: SAV_4873: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2)
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_2933: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2)
 
Streptomyces scabiei 87.22

Gene: SCAB_37601: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2)
Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2)
 
CRON 2.
qorR
*
Streptomyces coelicolor A3(2)

Site:
position = -38
score = 5.52258
sequence = GCACTCACTCATGGTGAGCGC

Gene: SCO4014: Redox-sensing transcriptional regulator QorR, HxlR family
*
Streptomyces avermitilis MA-4680

Site:
position = -44
score = 5.96986
sequence = GCACTAACTCAGCGAAAGTAC

Gene: SAV_4875: Redox-sensing transcriptional regulator QorR, HxlR family
*
Streptomyces griseus subsp. griseus NBRC 13350

Site:
position = -44
score = 5.76484
sequence = GCGCTAACTATGGGAAAGTAC

Gene: SGR_2931: Redox-sensing transcriptional regulator QorR, HxlR family
*
Streptomyces scabiei 87.22

Site:
position = -44
score = 5.88905
sequence = GCGCTAACTCTGCGAAAGTAC

Gene: SCAB_37581: Redox-sensing transcriptional regulator QorR, HxlR family
Redox-sensing transcriptional regulator QorR, HxlR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD