Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog AmtR - Mycobacteriaceae

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Nitrogen metabolism
Effector: GlnK-AMP, signal transduction protein
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Mycobacterium smegmatis str. MC2 155 5 1
Mycobacterium tuberculosis H37Rv
Mycobacterium abscessus ATCC 19977 5 2
Mycobacterium avium 104
Mycobacterium marinum M
Mycobacterium leprae TN
Mycobacterium vanbaalenii PYR-1
Mycobacterium flavescens PYR-GCK
Mycobacterium sp. JLS 5 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
amtR
 
Mycobacterium smegmatis str. MC2 155

Gene: MSMEG_4300: Transcriptional regulator of urea utilization, TetR family
 
Mycobacterium tuberculosis H37Rv
*
Mycobacterium abscessus ATCC 19977

Site:
position = -183
score = 5.85042
sequence = AATATCTGTCAGGCGATAGGTAAA

Gene: MAB_4089c: Transcriptional regulator of urea utilization, TetR family
 
Mycobacterium avium 104
 
Mycobacterium marinum M
 
Mycobacterium leprae TN
 
Mycobacterium vanbaalenii PYR-1
 
Mycobacterium flavescens PYR-GCK
*
Mycobacterium sp. JLS

Site:
position = -67
score = 6.26577
sequence = CGTTTCTGTCGTGTGACAGAAACC

Gene: Mjls_1823: Transcriptional regulator of urea utilization, TetR family
Transcriptional regulator of urea utilization, TetR family
 
CRON 2.
uctT
*
Mycobacterium smegmatis str. MC2 155

Site:
position = -60
score = 6.59364
sequence = GTTATCTGTCATCTGACAGGTAAG

Gene: MSMEG_2184: Urea carboxylase-related transporter, Amino acid permease family
 
Mycobacterium tuberculosis H37Rv
*
Mycobacterium abscessus ATCC 19977

Site:
position = -101
score = 5.85042
sequence = TTTACCTATCGCCTGACAGATATT

Gene: MAB_4090: Urea carboxylase-related transporter, Amino acid permease family
 
Mycobacterium avium 104
 
Mycobacterium marinum M
 
Mycobacterium leprae TN
 
Mycobacterium vanbaalenii PYR-1
 
Mycobacterium flavescens PYR-GCK
 
Mycobacterium sp. JLS
Urea carboxylase-related transporter, Amino acid permease family
amt1
 
Mycobacterium smegmatis str. MC2 155

Gene: MSMEG_2185: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
 
Mycobacterium tuberculosis H37Rv
 
Mycobacterium abscessus ATCC 19977

Gene: MAB_4091: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
 
Mycobacterium avium 104
 
Mycobacterium marinum M
 
Mycobacterium leprae TN
 
Mycobacterium vanbaalenii PYR-1
 
Mycobacterium flavescens PYR-GCK
*
Mycobacterium sp. JLS

Site:
position = -116
score = 5.4333
sequence = AAAACCTGTCACATGACAGACACA

Site:
position = -21
score = 6.17041
sequence = GAAAACTGTCAGGTGACAGAAATG

Gene: Mjls_1819: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
amt2
 
Mycobacterium smegmatis str. MC2 155

Gene: MSMEG_2186: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
 
Mycobacterium tuberculosis H37Rv
 
Mycobacterium abscessus ATCC 19977

Gene: MAB_4092: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
 
Mycobacterium avium 104
 
Mycobacterium marinum M
 
Mycobacterium leprae TN
 
Mycobacterium vanbaalenii PYR-1
 
Mycobacterium flavescens PYR-GCK
 
Mycobacterium sp. JLS

Gene: Mjls_1820: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
ucaA
 
Mycobacterium smegmatis str. MC2 155

Gene: MSMEG_2187: Urea carboxylase (EC 6.3.4.6)
 
Mycobacterium tuberculosis H37Rv
 
Mycobacterium abscessus ATCC 19977

Gene: MAB_4093: Urea carboxylase (EC 6.3.4.6)
 
Mycobacterium avium 104
 
Mycobacterium marinum M
 
Mycobacterium leprae TN
 
Mycobacterium vanbaalenii PYR-1
 
Mycobacterium flavescens PYR-GCK
 
Mycobacterium sp. JLS

Gene: Mjls_1821: Urea carboxylase (EC 6.3.4.6)
Urea carboxylase (EC 6.3.4.6)
ucaB
 
Mycobacterium smegmatis str. MC2 155

Gene: MSMEG_2189: Allophanate hydrolase (EC 3.5.1.54)
 
Mycobacterium tuberculosis H37Rv
 
Mycobacterium abscessus ATCC 19977

Gene: MAB_1558c: Allophanate hydrolase (EC 3.5.1.54)
 
Mycobacterium avium 104
 
Mycobacterium marinum M
 
Mycobacterium leprae TN
 
Mycobacterium vanbaalenii PYR-1
 
Mycobacterium flavescens PYR-GCK
 
Mycobacterium sp. JLS

Gene: Mjls_1822: Allophanate hydrolase (EC 3.5.1.54)
Allophanate hydrolase (EC 3.5.1.54)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD