Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Zur - Nocardiaceae

Properties
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 31 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Nocardia farcinica IFM 10152 14 5
Rhodococcus erythropolis PR4 12 5
Rhodococcus opacus B4 16 6
Rhodococcus sp. RHA1 16 6
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
yciC3
 
Nocardia farcinica IFM 10152

Gene: nfa53180: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
*
Rhodococcus erythropolis PR4

Site:
position = -25
score = 5.69713
sequence = TAATGACAATGGTTACCATTA

Gene: RER_14090: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
Rhodococcus opacus B4
*
Rhodococcus sp. RHA1

Site:
position = -25
score = 5.20476
sequence = TAATGAAAACAGTTATCATTT

Gene: RHA1_ro05533: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
CRON 2.
znuB2
*
Nocardia farcinica IFM 10152

Site:
position = -35
score = 5.1838
sequence = TAGTGATAATCGTTTTCATCT

Gene: nfa23260: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Rhodococcus erythropolis PR4
*
Rhodococcus opacus B4

Site:
position = -31
score = 5.74596
sequence = TTACGACAATCATTATCGTTA

Gene: ROP_22700: Zinc ABC transporter, inner membrane permease protein ZnuB
*
Rhodococcus sp. RHA1

Site:
position = -31
score = 5.74596
sequence = TTACGACAATCATTATCGTTA

Gene: RHA1_ro02546: Zinc ABC transporter, inner membrane permease protein ZnuB
Zinc ABC transporter, inner membrane permease protein ZnuB
ROP_22710
 
Nocardia farcinica IFM 10152
 
Rhodococcus erythropolis PR4
 
Rhodococcus opacus B4

Gene: ROP_22710: WD40/YVTN repeat-like-containing domain
 
Rhodococcus sp. RHA1

Gene: RHA1_ro02547: WD40/YVTN repeat-like-containing domain
WD40/YVTN repeat-like-containing domain
znuA2
 
Nocardia farcinica IFM 10152

Gene: nfa23270: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Rhodococcus erythropolis PR4
 
Rhodococcus opacus B4

Gene: ROP_22720: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Rhodococcus sp. RHA1

Gene: RHA1_ro02548: Zinc ABC transporter, periplasmic-binding protein ZnuA
Zinc ABC transporter, periplasmic-binding protein ZnuA
nfa23280
 
Nocardia farcinica IFM 10152

Gene: nfa23280: WD40/YVTN repeat-like-containing domain
*
Rhodococcus erythropolis PR4

Site:
position = -39
score = 4.99564
sequence = CTTTGACAATCATTTACATTA

Gene: RER_54290: WD40/YVTN repeat-like-containing domain
*
Rhodococcus opacus B4

Site:
position = -47
score = 4.58332
sequence = CTTTGACAACCGTTTGCAAAA

Gene: ROP_22730: WD40/YVTN repeat-like-containing domain
*
Rhodococcus sp. RHA1

Site:
position = -47
score = 4.7047
sequence = CTTTGACAACCGTTTGCAATA

Gene: RHA1_ro02549: WD40/YVTN repeat-like-containing domain
WD40/YVTN repeat-like-containing domain
 
CRON 3.
yciC
*
Nocardia farcinica IFM 10152

Site:
position = -88
score = 5.69589
sequence = TGATGACAATCGTTTTCGACA

Site:
position = -33
score = 5.44225
sequence = AAATGACAATCGTTATCGAAA

Gene: nfa49740: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
*
Rhodococcus erythropolis PR4

Site:
position = -84
score = 5.47748
sequence = AGATGACAATCGTTTTCGACA

Site:
position = -30
score = 5.05097
sequence = TAATGACAATCATTCCCAGAA

Gene: RER_44020: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
*
Rhodococcus opacus B4

Site:
position = -56
score = 5.76118
sequence = TGATGACAATCATTTTCGACA

Gene: ROP_56820: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
*
Rhodococcus sp. RHA1

Site:
position = -83
score = 5.76118
sequence = TGATGACAATCATTTTCGACA

Site:
position = -29
score = 5.66066
sequence = TAATGACAATCGTTATCGAAA

Gene: RHA1_ro05618: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
rpmE2
 
Nocardia farcinica IFM 10152

Gene: nfa49730: LSU ribosomal protein L31p
 
Rhodococcus erythropolis PR4

Gene: RER_44010: LSU ribosomal protein L31p
 
Rhodococcus opacus B4

Gene: ROP_56830: LSU ribosomal protein L31p
 
Rhodococcus sp. RHA1

Gene: RHA1_ro05619: LSU ribosomal protein L31p
LSU ribosomal protein L31p
rpmF2
 
Nocardia farcinica IFM 10152

Gene: nfa49720: LSU ribosomal protein L32p
 
Rhodococcus erythropolis PR4

Gene: RER_44000: LSU ribosomal protein L32p
 
Rhodococcus opacus B4

Gene: ROP_04720: LSU ribosomal protein L32p
 
Rhodococcus sp. RHA1

Gene: RHA1_ro05620: LSU ribosomal protein L32p
LSU ribosomal protein L32p
rpmJ2
 
Nocardia farcinica IFM 10152
 
Rhodococcus erythropolis PR4
*
Rhodococcus opacus B4

Site:
position = -30
score = 5.81741
sequence = TAACGACAATCGTTTTCAATA

Gene: ROP_04730: LSU ribosomal protein L36
 
Rhodococcus sp. RHA1
LSU ribosomal protein L36
 
CRON 4.
znuA
*
Nocardia farcinica IFM 10152

Site:
position = -27
score = 5.26472
sequence = TAATGGAAATCGTTTCCGTTT

Gene: nfa4450: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Rhodococcus erythropolis PR4

Site:
position = -56
score = 5.31931
sequence = TAACGGTAACGGTTTCCAATA

Gene: RER_07030: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Rhodococcus opacus B4

Site:
position = -28
score = 4.96522
sequence = CAACGGTAACGGTTTCCAATA

Gene: ROP_44070: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Rhodococcus sp. RHA1

Site:
position = -55
score = 4.96522
sequence = CAACGGTAACGGTTTCCAATA

Gene: RHA1_ro04479: Zinc ABC transporter, periplasmic-binding protein ZnuA
Zinc ABC transporter, periplasmic-binding protein ZnuA
znuC
 
Nocardia farcinica IFM 10152

Gene: nfa4440: Zinc ABC transporter, ATP-binding protein ZnuC
 
Rhodococcus erythropolis PR4

Gene: RER_07020: Zinc ABC transporter, ATP-binding protein ZnuC
 
Rhodococcus opacus B4

Gene: ROP_44060: Zinc ABC transporter, ATP-binding protein ZnuC
 
Rhodococcus sp. RHA1

Gene: RHA1_ro04478: Zinc ABC transporter, ATP-binding protein ZnuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
 
Nocardia farcinica IFM 10152

Gene: nfa4430: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Rhodococcus erythropolis PR4

Gene: RER_07010: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Rhodococcus opacus B4

Gene: ROP_44050: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Rhodococcus sp. RHA1

Gene: RHA1_ro04477: Zinc ABC transporter, inner membrane permease protein ZnuB
Zinc ABC transporter, inner membrane permease protein ZnuB
 
CRON 5.
rpmB2
*
Nocardia farcinica IFM 10152

Site:
position = -95
score = 5.44225
sequence = TTTCGATAACGATTGTCATTT

Site:
position = -40
score = 5.69589
sequence = TGTCGAAAACGATTGTCATCA

Gene: nfa49750: LSU ribosomal protein L28p
*
Rhodococcus erythropolis PR4

Site:
position = -41
score = 5.47748
sequence = TGTCGAAAACGATTGTCATCT

Site:
position = -95
score = 5.05097
sequence = TTCTGGGAATGATTGTCATTA

Gene: RER_44030: LSU ribosomal protein L28p
*
Rhodococcus opacus B4

Site:
position = -116
score = 5.66066
sequence = TTTCGATAACGATTGTCATTA

Site:
position = -62
score = 5.76118
sequence = TGTCGAAAATGATTGTCATCA

Gene: ROP_56810: LSU ribosomal protein L28p
*
Rhodococcus sp. RHA1

Site:
position = -117
score = 5.66066
sequence = TTTCGATAACGATTGTCATTA

Site:
position = -63
score = 5.76118
sequence = TGTCGAAAATGATTGTCATCA

Gene: RHA1_ro05617: LSU ribosomal protein L28p
LSU ribosomal protein L28p
rpmG2
 
Nocardia farcinica IFM 10152

Gene: nfa49760: LSU ribosomal protein L33p
 
Rhodococcus erythropolis PR4

Gene: RER_44040: LSU ribosomal protein L33p
 
Rhodococcus opacus B4

Gene: ROP_56800: LSU ribosomal protein L33p
 
Rhodococcus sp. RHA1

Gene: RHA1_ro05616: LSU ribosomal protein L33p
LSU ribosomal protein L33p
rpsN2
 
Nocardia farcinica IFM 10152

Gene: nfa49770: SSU ribosomal protein S14p (S29e)
 
Rhodococcus erythropolis PR4

Gene: RER_44050: SSU ribosomal protein S14p (S29e)
 
Rhodococcus opacus B4

Gene: ROP_56790: SSU ribosomal protein S14p (S29e)
 
Rhodococcus sp. RHA1

Gene: RHA1_ro05615: SSU ribosomal protein S14p (S29e)
SSU ribosomal protein S14p (S29e)
rpsR2
 
Nocardia farcinica IFM 10152

Gene: nfa49780: SSU ribosomal protein S18p
 
Rhodococcus erythropolis PR4

Gene: RER_44060: SSU ribosomal protein S18p
 
Rhodococcus opacus B4

Gene: ROP_56780: SSU ribosomal protein S18p
 
Rhodococcus sp. RHA1

Gene: RHA1_ro05614: SSU ribosomal protein S18p
SSU ribosomal protein S18p
 
CRON 6.
znuC2
*
Nocardia farcinica IFM 10152

Site:
position = -45
score = 5.1838
sequence = AGATGAAAACGATTATCACTA

Gene: nfa23250: Zinc ABC transporter, ATP-binding protein ZnuC
 
Rhodococcus erythropolis PR4
*
Rhodococcus opacus B4

Site:
position = -8
score = 5.74596
sequence = TAACGATAATGATTGTCGTAA

Gene: ROP_22690: Zinc ABC transporter, ATP-binding protein ZnuC
*
Rhodococcus sp. RHA1

Site:
position = -8
score = 5.74596
sequence = TAACGATAATGATTGTCGTAA

Gene: RHA1_ro02545: Zinc ABC transporter, ATP-binding protein ZnuC
Zinc ABC transporter, ATP-binding protein ZnuC
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD