Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog QorR - Micrococcineae

Properties
Regulator type: Transcription factor
Regulator family: HxlR
Regulation mode: repressor
Biological process: Energy metabolism
Effector:
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Arthrobacter aurescens TC1
Arthrobacter chlorophenolicus A6 2 2
Arthrobacter sp. FB24
Beutenbergia cavernae DSM 12333
Brachybacterium faecium DSM 4810
Brevibacterium linens BL2
Clavibacter michiganensis subsp. michiganensis NCPPB 382 1 1
Janibacter sp. HTCC2649 2 2
Jonesia denitrificans DSM 20603
Kocuria rhizophila DC2201 1 1
Kytococcus sedentarius DSM 20547
Leifsonia xyli subsp. xyli str. CTCB07
Renibacterium salmoninarum ATCC 33209
Tropheryma whipplei str. Twist
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
qorR
 
Arthrobacter aurescens TC1
*
Arthrobacter chlorophenolicus A6

Site:
position = -62
score = 5.78654
sequence = CGCACTTTGAAGTAAGGTACT

Gene: Achl_0580: Redox-sensing transcriptional regulator QorR, HxlR family
 
Arthrobacter sp. FB24
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
*
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Site:
position = -34
score = 4.63907
sequence = CCCACTTTCTGGTAAGTTGTG

Gene: CMM_2832: Redox-sensing transcriptional regulator QorR, HxlR family
*
Janibacter sp. HTCC2649

Site:
position = -42
score = 5.85147
sequence = CCCACTTTGAAGTAAGGTACG

Gene: JNB_06539: Redox-sensing transcriptional regulator QorR, HxlR family
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Redox-sensing transcriptional regulator QorR, HxlR family
 
CRON 2.
qorB
 
Arthrobacter aurescens TC1
*
Arthrobacter chlorophenolicus A6

Site:
position = -94
score = 5.78654
sequence = AGTACCTTACTTCAAAGTGCG

Gene: Achl_0581: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2)
 
Arthrobacter sp. FB24
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
*
Janibacter sp. HTCC2649

Site:
position = -39
score = 5.85147
sequence = CGTACCTTACTTCAAAGTGGG

Gene: JNB_06534: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2)
 
Jonesia denitrificans DSM 20603
*
Kocuria rhizophila DC2201

Site:
position = -92
score = 4.59885
sequence = AGTGCCTTACTGCGAAGTGCG

Site:
position = -35
score = 4.4713
sequence = TGTACCTTCCGTCAAGGACCC

Gene: KRH_16940: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2)
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD