Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PaaR - Nocardiaceae

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Phenylacetic acid degradation
Effector: Phenylacetyl-CoA
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 22 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Nocardia farcinica IFM 10152 15 4
Rhodococcus erythropolis PR4 10 3
Rhodococcus opacus B4 16 4
Rhodococcus sp. RHA1 16 5
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
paaJ
*
Nocardia farcinica IFM 10152

Site:
position = -49
score = 5.9106
sequence = ACTGACCGAATGTTCGGTAATA

Gene: nfa21570: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
 
Rhodococcus erythropolis PR4
*
Rhodococcus opacus B4

Site:
position = -148
score = 5.37147
sequence = TTTCACCGTACGTTCGGTCGGT

Site:
position = -53
score = 5.70362
sequence = ACCGACCGAAGATTCGGTTATT

Gene: ROP_25860: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
*
Rhodococcus sp. RHA1

Site:
position = -149
score = 5.37147
sequence = TTTCACCGTACGTTCGGTCGGT

Site:
position = -53
score = 5.70362
sequence = ACCGACCGAAGATTCGGTTATT

Gene: RHA1_ro02863: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
paaF
 
Nocardia farcinica IFM 10152

Gene: nfa21580: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Rhodococcus erythropolis PR4

Gene: RER_55530: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Rhodococcus opacus B4

Gene: ROP_25850: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Rhodococcus sp. RHA1

Gene: RHA1_ro02862: Enoyl-CoA hydratase (EC 4.2.1.17)
Enoyl-CoA hydratase (EC 4.2.1.17)
paaH
 
Nocardia farcinica IFM 10152

Gene: nfa21590: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
 
Rhodococcus erythropolis PR4

Gene: RER_55520: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
 
Rhodococcus opacus B4

Gene: ROP_25840: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
 
Rhodococcus sp. RHA1

Gene: RHA1_ro02861: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
paaG
 
Nocardia farcinica IFM 10152

Gene: nfa21600: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Rhodococcus erythropolis PR4

Gene: RER_55510: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Rhodococcus opacus B4

Gene: ROP_25830: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Rhodococcus sp. RHA1

Gene: RHA1_ro02860: Enoyl-CoA hydratase (EC 4.2.1.17)
Enoyl-CoA hydratase (EC 4.2.1.17)
paaA
 
Nocardia farcinica IFM 10152

Gene: nfa21610: Phenylacetate-CoA oxygenase, PaaA subunit
*
Rhodococcus erythropolis PR4

Site:
position = -35
score = 5.63991
sequence = ACCAACCGATCATTCGGTAATA

Gene: RER_55500: Phenylacetate-CoA oxygenase, PaaA subunit
 
Rhodococcus opacus B4

Gene: ROP_25820: Phenylacetate-CoA oxygenase, PaaA subunit
*
Rhodococcus sp. RHA1

Site:
position = -34
score = 5.63991
sequence = ACCAACCGATCATTCGGTAATA

Gene: RHA1_ro02859: Phenylacetate-CoA oxygenase, PaaA subunit
Phenylacetate-CoA oxygenase, PaaA subunit
paaB
 
Nocardia farcinica IFM 10152

Gene: nfa21620: Phenylacetate-CoA oxygenase, PaaB subunit
 
Rhodococcus erythropolis PR4

Gene: RER_55490: Phenylacetate-CoA oxygenase, PaaB subunit
 
Rhodococcus opacus B4

Gene: ROP_25810: Phenylacetate-CoA oxygenase, PaaB subunit
 
Rhodococcus sp. RHA1

Gene: RHA1_ro02858: Phenylacetate-CoA oxygenase, PaaB subunit
Phenylacetate-CoA oxygenase, PaaB subunit
paaC
 
Nocardia farcinica IFM 10152

Gene: nfa21630: Phenylacetate-CoA oxygenase, PaaC subunit
 
Rhodococcus erythropolis PR4

Gene: RER_55480: Phenylacetate-CoA oxygenase, PaaC subunit
 
Rhodococcus opacus B4

Gene: ROP_25800: Phenylacetate-CoA oxygenase, PaaC subunit
 
Rhodococcus sp. RHA1

Gene: RHA1_ro02857: Phenylacetate-CoA oxygenase, PaaC subunit
Phenylacetate-CoA oxygenase, PaaC subunit
paaD
 
Nocardia farcinica IFM 10152

Gene: nfa21640: Phenylacetate-CoA oxygenase, PaaD subunit
 
Rhodococcus erythropolis PR4

Gene: RER_55470: Phenylacetate-CoA oxygenase, PaaD subunit
 
Rhodococcus opacus B4

Gene: ROP_25790: Phenylacetate-CoA oxygenase, PaaD subunit
 
Rhodococcus sp. RHA1

Gene: RHA1_ro02856: Phenylacetate-CoA oxygenase, PaaD subunit
Phenylacetate-CoA oxygenase, PaaD subunit
paaE
 
Nocardia farcinica IFM 10152

Gene: nfa21650: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Rhodococcus erythropolis PR4

Gene: RER_55460: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Rhodococcus opacus B4

Gene: ROP_25780: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Rhodococcus sp. RHA1

Gene: RHA1_ro02855: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
paaK
 
Nocardia farcinica IFM 10152

Gene: nfa21660: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Rhodococcus erythropolis PR4

Gene: RER_55450: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Rhodococcus opacus B4

Gene: ROP_25770: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Rhodococcus sp. RHA1

Gene: RHA1_ro02854: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
paaQ
*
Nocardia farcinica IFM 10152

Site:
position = -78
score = 5.75507
sequence = ACTGACCGAACAGTCGGTAATA

Gene: nfa20960: Transcriptional regulator, AraC family
 
Rhodococcus erythropolis PR4
 
Rhodococcus opacus B4

Gene: ROP_25760: Transcriptional regulator, AraC family
 
Rhodococcus sp. RHA1

Gene: RHA1_ro02853: Transcriptional regulator, AraC family
Transcriptional regulator, AraC family
 
CRON 2.
paaZ
*
Nocardia farcinica IFM 10152

Site:
position = -32
score = 5.32913
sequence = ACCGACCGAATGTTCAGTTGAA

Gene: nfa21550: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
*
Rhodococcus erythropolis PR4

Site:
position = -32
score = 5.60354
sequence = ACCGACCGAACGTACGGTGAGA

Gene: RER_55550: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
*
Rhodococcus opacus B4

Site:
position = -127
score = 5.70362
sequence = AATAACCGAATCTTCGGTCGGT

Site:
position = -32
score = 5.37147
sequence = ACCGACCGAACGTACGGTGAAA

Gene: ROP_25870: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
*
Rhodococcus sp. RHA1

Site:
position = -128
score = 5.70362
sequence = AATAACCGAATCTTCGGTCGGT

Site:
position = -32
score = 5.37147
sequence = ACCGACCGAACGTACGGTGAAA

Gene: RHA1_ro02864: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
ethD
 
Nocardia farcinica IFM 10152

Gene: nfa21540: Possible ethyl tert-butyl ether degradation protein EthD
 
Rhodococcus erythropolis PR4

Gene: RER_55560: Possible ethyl tert-butyl ether degradation protein EthD
 
Rhodococcus opacus B4

Gene: ROP_25880: Possible ethyl tert-butyl ether degradation protein EthD
 
Rhodococcus sp. RHA1

Gene: RHA1_ro02865: Possible ethyl tert-butyl ether degradation protein EthD
Possible ethyl tert-butyl ether degradation protein EthD
paaI
 
Nocardia farcinica IFM 10152

Gene: nfa21530: Phenylacetic acid degradation protein PaaI, thioesterase
 
Rhodococcus erythropolis PR4

Gene: RER_55570: Phenylacetic acid degradation protein PaaI, thioesterase
 
Rhodococcus opacus B4

Gene: ROP_25890: Phenylacetic acid degradation protein PaaI, thioesterase
 
Rhodococcus sp. RHA1

Gene: RHA1_ro02866: Phenylacetic acid degradation protein PaaI, thioesterase
Phenylacetic acid degradation protein PaaI, thioesterase
 
CRON 3.
paaR
*
Nocardia farcinica IFM 10152

Site:
position = -81
score = 5.9106
sequence = TATTACCGAACATTCGGTCAGT

Gene: nfa21560: Transcriptional regulator of phenylacetic acid degradation, TetR family
*
Rhodococcus erythropolis PR4

Site:
position = -80
score = 5.98634
sequence = AATAACCGAACATTCGGTCGTT

Gene: RER_55540: Transcriptional regulator of phenylacetic acid degradation, TetR family
*
Rhodococcus opacus B4

Site:
position = -80
score = 4.82171
sequence = CTGAACCGAACCTTCGGTCGGC

Gene: ROP_23860: Transcriptional regulator of phenylacetic acid degradation, TetR family
*
Rhodococcus sp. RHA1

Site:
position = -80
score = 5.21938
sequence = TTCAACCGAACCTTCGGTCGGC

Gene: RHA1_ro02633: Transcriptional regulator of phenylacetic acid degradation, TetR family
Transcriptional regulator of phenylacetic acid degradation, TetR family
 
CRON 4.
paaT
 
Nocardia farcinica IFM 10152
 
Rhodococcus erythropolis PR4
*
Rhodococcus opacus B4

Site:
position = -122
score = 5.71141
sequence = ACCAACCGAACGTACGGTTATA

Site:
position = -39
score = 5.44463
sequence = CCTGACCGAACAATCGGTCGAG

Gene: ROP_17540: Predicted phylacetic acid transporter PaaT
*
Rhodococcus sp. RHA1

Site:
position = -124
score = 5.71141
sequence = ACCAACCGAACGTACGGTTATA

Site:
position = -40
score = 5.10434
sequence = CCTGACCGAACAGTCGTTCGCA

Gene: RHA1_ro02082: Predicted phylacetic acid transporter PaaT
Predicted phylacetic acid transporter PaaT
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD