Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SoxR - Shewanellaceae

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: repressor
Biological process: Superoxide stress response
Effector: Paraquat
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 12 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Shewanella oneidensis MR-1
Shewanella putrefaciens CN-32
Shewanella sp W3-18-1
Shewanella sp ANA-3
Shewanella sp MR-4
Shewanella sp MR-7
Shewanella baltica OS155
Shewanella denitrificans OS217 3 3
Shewanella frigidimarina NCIMB 400 2 2
Shewanella amazonensis SB2B 2 2
Shewanella loihica PV-4 2 2
Shewanella pealeana ATCC 700345
Shewanella halifaxensis HAW-EB4
Shewanella piezotolerans WP3 3 2
Shewanella sediminis HAW-EB3
Shewanella woodyi ATCC 51908 1 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
acrA
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217

Gene: Sden_1586: Probable RND efflux membrane fusion protein
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
*
Shewanella piezotolerans WP3

Site:
position = -69
score = 6.72362
sequence = ACCTCAAGTTAACTTGATGT

Gene: swp_2308: Probable RND efflux membrane fusion protein
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Probable RND efflux membrane fusion protein
acrB
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217

Gene: Sden_1587: RND multidrug efflux transporter
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3

Gene: swp_2309: RND multidrug efflux transporter
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
RND multidrug efflux transporter
 
CRON 2.
PF11158
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
*
Shewanella amazonensis SB2B

Site:
position = -62
score = 6.19153
sequence = ACCTCAAGTTGACTTGAAGT

Gene: Sama_3348: Protein of unknown function DUF2938
*
Shewanella loihica PV-4

Site:
position = -65
score = 5.65944
sequence = ACCTCAAGTCGACTTGAAGT

Gene: Shew_0422: Protein of unknown function DUF2938
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Protein of unknown function DUF2938
 
CRON 3.
soxR
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
*
Shewanella denitrificans OS217

Site:
position = -116
score = 7.25571
sequence = ACCTCAAGTTAGCTTGAGGT

Gene: Sden_2125: Redox-sensitive transcriptional activator, MerR family
*
Shewanella frigidimarina NCIMB 400

Site:
position = -64
score = 7.00063
sequence = ACCTAAAGCTAACTTGAGGT

Gene: Sfri_1565: Redox-sensitive transcriptional activator, MerR family
*
Shewanella amazonensis SB2B

Site:
position = -32
score = 6.19153
sequence = ACTTCAAGTCAACTTGAGGT

Gene: Sama_3347: Redox-sensitive transcriptional activator, MerR family
*
Shewanella loihica PV-4

Site:
position = -32
score = 5.65944
sequence = ACTTCAAGTCGACTTGAGGT

Gene: Shew_0423: Redox-sensitive transcriptional activator, MerR family
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
*
Shewanella piezotolerans WP3

Site:
position = -49
score = 6.00019
sequence = ATCTCAAGTTAACTTTAGAT

Gene: swp_2307: Redox-sensitive transcriptional activator, MerR family
 
Shewanella sediminis HAW-EB3
*
Shewanella woodyi ATCC 51908

Site:
position = -113
score = 4.36212
sequence = AgtTaAAGTcgACTTtAaGT

Gene: Swoo_3439: Redox-sensitive transcriptional activator, MerR family
Redox-sensitive transcriptional activator, MerR family
 
CRON 4.
PF00903
 
Shewanella oneidensis MR-1

Gene: SO_3586: Glyoxalase/bleomycin resistance protein/dioxygenase
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1016: Glyoxalase/bleomycin resistance protein/dioxygenase
 
Shewanella sp W3-18-1

Gene: Sputw3181_3149: Glyoxalase/bleomycin resistance protein/dioxygenase
 
Shewanella sp ANA-3

Gene: Shewana3_3178: Glyoxalase/bleomycin resistance protein/dioxygenase
 
Shewanella sp MR-4

Gene: Shewmr4_3000: Glyoxalase/bleomycin resistance protein/dioxygenase
 
Shewanella sp MR-7

Gene: Shewmr7_3081: Glyoxalase/bleomycin resistance protein/dioxygenase
 
Shewanella baltica OS155

Gene: Sbal_1009: Glyoxalase/bleomycin resistance protein/dioxygenase
*
Shewanella denitrificans OS217

Site:
position = -56
score = 7.25571
sequence = ACCTCAAGCTAACTTGAGGT

Gene: Sden_2124: Glyoxalase/bleomycin resistance protein/dioxygenase
*
Shewanella frigidimarina NCIMB 400

Site:
position = -57
score = 7.00063
sequence = ACCTCAAGTTAGCTTTAGGT

Gene: Sfri_1566: Glyoxalase/bleomycin resistance protein/dioxygenase
 
Shewanella amazonensis SB2B

Gene: Sama_2789: Glyoxalase/bleomycin resistance protein/dioxygenase
 
Shewanella loihica PV-4

Gene: Shew_0913: Glyoxalase/bleomycin resistance protein/dioxygenase
 
Shewanella pealeana ATCC 700345

Gene: Spea_0886: Glyoxalase/bleomycin resistance protein/dioxygenase
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_0938: Glyoxalase/bleomycin resistance protein/dioxygenase
 
Shewanella piezotolerans WP3

Gene: swp_0890: Glyoxalase/bleomycin resistance protein/dioxygenase
 
Shewanella sediminis HAW-EB3

Gene: Ssed_0992: Glyoxalase/bleomycin resistance protein/dioxygenase
 
Shewanella woodyi ATCC 51908

Gene: Swoo_1045: Glyoxalase/bleomycin resistance protein/dioxygenase
Glyoxalase/bleomycin resistance protein/dioxygenase
 
CRON 5.
Sden_0647
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
*
Shewanella denitrificans OS217

Site:
position = -61
score = 7.00063
sequence = ACCTCAAGTTAGCTTGAGCT

Gene: Sden_0647: Endoribonuclease L-PSP
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Endoribonuclease L-PSP
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD