Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PaaR - Frankineae/Propionibacterineae/Pseudonocardiaceae

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Phenylacetic acid degradation
Effector: Phenylacetyl-CoA
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 14 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Nocardioides sp. JS614
Propionibacterium acnes KPA171202
Frankia sp. CcI3
Frankia sp. EAN1pec
Acidothermus cellulolyticus 11B 7 2
Nakamurella multipartita DSM 44233 10 2
Actinosynnema mirum DSM 43827
Saccharomonospora viridis DSM 43017 10 3
Saccharopolyspora erythraea NRRL 2338 8 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
paaA
 
Nocardioides sp. JS614

Gene: Noca_3159: Phenylacetate-CoA oxygenase, PaaA subunit
 
Propionibacterium acnes KPA171202
 
Frankia sp. CcI3
 
Frankia sp. EAN1pec
*
Acidothermus cellulolyticus 11B

Site:
position = -41
score = 5.70798
sequence = GTCAACCGAACATTCGGTCGGT

Gene: Acel_1443: Phenylacetate-CoA oxygenase, PaaA subunit
*
Nakamurella multipartita DSM 44233

Site:
position = -70
score = 5.64783
sequence = TCTTACTGACCGTTCGGTCAGT

Site:
position = -66
score = 4.98581
sequence = ACTGACCGTTCGGTCAGTTACA

Gene: Namu_2491: Phenylacetate-CoA oxygenase, PaaA subunit
 
Actinosynnema mirum DSM 43827

Gene: Amir_6692: Phenylacetate-CoA oxygenase, PaaA subunit
 
Saccharomonospora viridis DSM 43017

Gene: Svir_26530: Phenylacetate-CoA oxygenase, PaaA subunit
 
Saccharopolyspora erythraea NRRL 2338

Gene: SACE_3544: Phenylacetate-CoA oxygenase, PaaA subunit
Phenylacetate-CoA oxygenase, PaaA subunit
paaB
 
Nocardioides sp. JS614

Gene: Noca_3158: Phenylacetate-CoA oxygenase, PaaB subunit
 
Propionibacterium acnes KPA171202
 
Frankia sp. CcI3
 
Frankia sp. EAN1pec
 
Acidothermus cellulolyticus 11B

Gene: Acel_1442: Phenylacetate-CoA oxygenase, PaaB subunit
 
Nakamurella multipartita DSM 44233

Gene: Namu_2490: Phenylacetate-CoA oxygenase, PaaB subunit
 
Actinosynnema mirum DSM 43827

Gene: Amir_6691: Phenylacetate-CoA oxygenase, PaaB subunit
 
Saccharomonospora viridis DSM 43017

Gene: Svir_26520: Phenylacetate-CoA oxygenase, PaaB subunit
 
Saccharopolyspora erythraea NRRL 2338

Gene: SACE_3545: Phenylacetate-CoA oxygenase, PaaB subunit
Phenylacetate-CoA oxygenase, PaaB subunit
paaC
 
Nocardioides sp. JS614

Gene: Noca_3157: Phenylacetate-CoA oxygenase, PaaC subunit
 
Propionibacterium acnes KPA171202
 
Frankia sp. CcI3
 
Frankia sp. EAN1pec
 
Acidothermus cellulolyticus 11B

Gene: Acel_1441: Phenylacetate-CoA oxygenase, PaaC subunit
 
Nakamurella multipartita DSM 44233

Gene: Namu_2489: Phenylacetate-CoA oxygenase, PaaC subunit
 
Actinosynnema mirum DSM 43827

Gene: Amir_6690: Phenylacetate-CoA oxygenase, PaaC subunit
 
Saccharomonospora viridis DSM 43017

Gene: Svir_26510: Phenylacetate-CoA oxygenase, PaaC subunit
 
Saccharopolyspora erythraea NRRL 2338

Gene: SACE_3546: Phenylacetate-CoA oxygenase, PaaC subunit
Phenylacetate-CoA oxygenase, PaaC subunit
paaD
 
Nocardioides sp. JS614

Gene: Noca_3156: Phenylacetate-CoA oxygenase, PaaD subunit
 
Propionibacterium acnes KPA171202
 
Frankia sp. CcI3
 
Frankia sp. EAN1pec
 
Acidothermus cellulolyticus 11B

Gene: Acel_1440: Phenylacetate-CoA oxygenase, PaaD subunit
 
Nakamurella multipartita DSM 44233

Gene: Namu_2488: Phenylacetate-CoA oxygenase, PaaD subunit
 
Actinosynnema mirum DSM 43827

Gene: Amir_6689: Phenylacetate-CoA oxygenase, PaaD subunit
 
Saccharomonospora viridis DSM 43017

Gene: Svir_26500: Phenylacetate-CoA oxygenase, PaaD subunit
 
Saccharopolyspora erythraea NRRL 2338

Gene: SACE_3547: Phenylacetate-CoA oxygenase, PaaD subunit
Phenylacetate-CoA oxygenase, PaaD subunit
paaE
 
Nocardioides sp. JS614

Gene: Noca_3155: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Propionibacterium acnes KPA171202
 
Frankia sp. CcI3
 
Frankia sp. EAN1pec
 
Acidothermus cellulolyticus 11B

Gene: Acel_1439: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Nakamurella multipartita DSM 44233

Gene: Namu_2487: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Actinosynnema mirum DSM 43827

Gene: Amir_6688: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Saccharomonospora viridis DSM 43017

Gene: Svir_26490: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Saccharopolyspora erythraea NRRL 2338

Gene: SACE_3548: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
Namu_2486
 
Nocardioides sp. JS614
 
Propionibacterium acnes KPA171202
 
Frankia sp. CcI3
 
Frankia sp. EAN1pec
 
Acidothermus cellulolyticus 11B
 
Nakamurella multipartita DSM 44233

Gene: Namu_2486: hypothetical protein
 
Actinosynnema mirum DSM 43827
 
Saccharomonospora viridis DSM 43017
 
Saccharopolyspora erythraea NRRL 2338
hypothetical protein
paaZ
 
Nocardioides sp. JS614
 
Propionibacterium acnes KPA171202
 
Frankia sp. CcI3
 
Frankia sp. EAN1pec
*
Acidothermus cellulolyticus 11B

Site:
position = -177
score = 5.33565
sequence = GCCGACCGAACGTTCGGTCTAG

Gene: Acel_1435: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
 
Nakamurella multipartita DSM 44233

Gene: Namu_2485: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
 
Actinosynnema mirum DSM 43827
*
Saccharomonospora viridis DSM 43017

Site:
position = -39
score = 5.34266
sequence = ACTTCCTGAACGTTCGGTTGGT

Gene: Svir_26540: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
*
Saccharopolyspora erythraea NRRL 2338

Site:
position = -186
score = 5.46792
sequence = ACTGACCGAGTAGTCGGTTATT

Site:
position = -52
score = 5.45253
sequence = CGTTACCGAACGAACGGTCGGT

Site:
position = -48
score = 5.4452
sequence = ACCGAACGAACGGTCGGTAAAA

Gene: SACE_3543: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
paaR
 
Nocardioides sp. JS614
 
Propionibacterium acnes KPA171202
 
Frankia sp. CcI3
 
Frankia sp. EAN1pec
 
Acidothermus cellulolyticus 11B

Gene: Acel_1436: Transcriptional regulator of phenylacetic acid degradation, TetR family
*
Nakamurella multipartita DSM 44233

Site:
position = -43
score = 5.95483
sequence = ACTGACCGAATGATCGGTCAGC

Gene: Namu_2483: Transcriptional regulator of phenylacetic acid degradation, TetR family
 
Actinosynnema mirum DSM 43827
 
Saccharomonospora viridis DSM 43017

Gene: Svir_26580: Transcriptional regulator of phenylacetic acid degradation, TetR family
 
Saccharopolyspora erythraea NRRL 2338

Gene: SACE_3541: Transcriptional regulator of phenylacetic acid degradation, TetR family
Transcriptional regulator of phenylacetic acid degradation, TetR family
paaH
 
Nocardioides sp. JS614
 
Propionibacterium acnes KPA171202
 
Frankia sp. CcI3
 
Frankia sp. EAN1pec
 
Acidothermus cellulolyticus 11B

Gene: Acel_0147: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
 
Nakamurella multipartita DSM 44233

Gene: Namu_2482: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
 
Actinosynnema mirum DSM 43827
*
Saccharomonospora viridis DSM 43017

Site:
position = -116
score = 5.63002
sequence = ACTGACCGAATGGACGGTTACT

Gene: Svir_26550: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
 
Saccharopolyspora erythraea NRRL 2338
3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
paaI
 
Nocardioides sp. JS614
 
Propionibacterium acnes KPA171202
 
Frankia sp. CcI3
 
Frankia sp. EAN1pec
 
Acidothermus cellulolyticus 11B
 
Nakamurella multipartita DSM 44233

Gene: Namu_2481: Phenylacetic acid degradation protein PaaI, thioesterase
 
Actinosynnema mirum DSM 43827
*
Saccharomonospora viridis DSM 43017

Site:
position = -42
score = 5.63002
sequence = AGTAACCGTCCATTCGGTCAGT

Gene: Svir_26560: Phenylacetic acid degradation protein PaaI, thioesterase
 
Saccharopolyspora erythraea NRRL 2338
Phenylacetic acid degradation protein PaaI, thioesterase
paaK
 
Nocardioides sp. JS614
 
Propionibacterium acnes KPA171202
 
Frankia sp. CcI3
 
Frankia sp. EAN1pec
 
Acidothermus cellulolyticus 11B
 
Nakamurella multipartita DSM 44233
 
Actinosynnema mirum DSM 43827
 
Saccharomonospora viridis DSM 43017

Gene: Svir_26570: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
*
Saccharopolyspora erythraea NRRL 2338

Site:
position = -232
score = 5.4452
sequence = TTTTACCGACCGTTCGTTCGGT

Site:
position = -228
score = 5.45253
sequence = ACCGACCGTTCGTTCGGTAACG

Site:
position = -94
score = 5.46792
sequence = AATAACCGACTACTCGGTCAGT

Gene: SACE_3542: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD