Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog QorR - Frankineae/Propionibacterineae/Pseudonocardiaceae

Properties
Regulator type: Transcription factor
Regulator family: HxlR
Regulation mode: repressor
Biological process: Energy metabolism
Effector:
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Saccharomonospora viridis DSM 43017
Actinosynnema mirum DSM 43827
Saccharopolyspora erythraea NRRL 2338 2 2
Nakamurella multipartita DSM 44233
Frankia sp. EAN1pec 2 2
Frankia sp. CcI3 2 2
Acidothermus cellulolyticus 11B
Nocardioides sp. JS614
Propionibacterium acnes KPA171202
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
qorB
 
Saccharomonospora viridis DSM 43017
 
Actinosynnema mirum DSM 43827
*
Saccharopolyspora erythraea NRRL 2338

Site:
position = -51
score = 4.84642
sequence = CTGGTTACCAATCGATACCGT

Gene: SACE_0813: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2)
 
Nakamurella multipartita DSM 44233
*2
Frankia sp. EAN1pec

Site:
position = -89
score = 5.3251
sequence = CCGCTATCCGGGAGGTAACCG

Gene: Franean1_1882: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2)

Gene: Franean1_1760: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2)
*
Frankia sp. CcI3

Site:
position = -87
score = 5.8026
sequence = CCGGTATCCCCGCGGTAACCG

Gene: Francci3_2018: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2)
 
Acidothermus cellulolyticus 11B
 
Nocardioides sp. JS614
 
Propionibacterium acnes KPA171202
Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2)
 
CRON 2.
qorR
 
Saccharomonospora viridis DSM 43017
 
Actinosynnema mirum DSM 43827
*
Saccharopolyspora erythraea NRRL 2338

Site:
position = -47
score = 4.84642
sequence = ACGGTATCGATTGGTAACCAG

Gene: SACE_0812: Redox-sensing transcriptional regulator QorR, HxlR family
 
Nakamurella multipartita DSM 44233
*
Frankia sp. EAN1pec

Site:
position = -34
score = 5.3251
sequence = CGGTTACCTCCCGGATAGCGG

Gene: Franean1_1881: Redox-sensing transcriptional regulator QorR, HxlR family
*
Frankia sp. CcI3

Site:
position = -42
score = 5.8026
sequence = CGGTTACCGCGGGGATACCGG

Gene: Francci3_2019: Redox-sensing transcriptional regulator QorR, HxlR family
 
Acidothermus cellulolyticus 11B
 
Nocardioides sp. JS614
 
Propionibacterium acnes KPA171202
Redox-sensing transcriptional regulator QorR, HxlR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD