Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog AmtR - Nocardiaceae

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Nitrogen metabolism
Effector: GlnK-AMP, signal transduction protein
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Nocardia farcinica IFM 10152 6 2
Rhodococcus erythropolis PR4 5 2
Rhodococcus opacus B4 5 2
Rhodococcus sp. RHA1 1 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
uctT
*
Nocardia farcinica IFM 10152

Site:
position = -51
score = 6.36232
sequence = CAAAACTATCAACCGACAGATATT

Gene: nfa22220: Urea carboxylase-related transporter, Amino acid permease family
*
Rhodococcus erythropolis PR4

Site:
position = -58
score = 6.8596
sequence = GAAAACTATCAATCGACAGTTATT

Gene: RER_29520: Urea carboxylase-related transporter, Amino acid permease family
*
Rhodococcus opacus B4

Site:
position = -47
score = 6.8596
sequence = GAAAACTATCGATCGACAGATATT

Gene: ROP_68880: Urea carboxylase-related transporter, Amino acid permease family
 
Rhodococcus sp. RHA1
Urea carboxylase-related transporter, Amino acid permease family
amt1
 
Nocardia farcinica IFM 10152

Gene: nfa22210: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
 
Rhodococcus erythropolis PR4

Gene: RER_29530: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
 
Rhodococcus opacus B4

Gene: ROP_68890: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
 
Rhodococcus sp. RHA1
Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
amt2
 
Nocardia farcinica IFM 10152

Gene: nfa22200: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
 
Rhodococcus erythropolis PR4

Gene: RER_29540: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
 
Rhodococcus opacus B4

Gene: ROP_68900: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
 
Rhodococcus sp. RHA1
Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
ucaA
 
Nocardia farcinica IFM 10152

Gene: nfa22190: Urea carboxylase (EC 6.3.4.6)
 
Rhodococcus erythropolis PR4

Gene: RER_29550: Urea carboxylase (EC 6.3.4.6)
 2
Rhodococcus opacus B4

Gene: ROP_68910: Urea carboxylase (EC 6.3.4.6)

Gene: ROP_18530: Urea carboxylase (EC 6.3.4.6)
 
Rhodococcus sp. RHA1

Gene: RHA1_ro02135: Urea carboxylase (EC 6.3.4.6)
Urea carboxylase (EC 6.3.4.6)
ucaB
 
Nocardia farcinica IFM 10152

Gene: nfa22180: Allophanate hydrolase (EC 3.5.1.54)
 
Rhodococcus erythropolis PR4

Gene: RER_15450: Allophanate hydrolase (EC 3.5.1.54)
 
Rhodococcus opacus B4

Gene: ROP_18540: Allophanate hydrolase (EC 3.5.1.54)
 
Rhodococcus sp. RHA1

Gene: RHA1_ro02136: Allophanate hydrolase (EC 3.5.1.54)
Allophanate hydrolase (EC 3.5.1.54)
 
CRON 2.
amtR
*
Nocardia farcinica IFM 10152

Site:
position = -160
score = 6.71086
sequence = AATATCTGTCGGTTGATAGTTTTG

Gene: nfa22230: Transcriptional regulator of urea utilization, TetR family
*
Rhodococcus erythropolis PR4

Site:
position = -172
score = 7.14326
sequence = AATAACTGTCGATTGATAGTTTTC

Gene: RER_29510: Transcriptional regulator of urea utilization, TetR family
*
Rhodococcus opacus B4

Site:
position = -171
score = 7.23908
sequence = AATATCTGTCGATCGATAGTTTTC

Gene: ROP_68870: Transcriptional regulator of urea utilization, TetR family
*
Rhodococcus sp. RHA1

Site:
position = -170
score = 7.00515
sequence = AATATCTGTCGCTCGATAGTTTTC

Gene: RHA1_ro06918: Transcriptional regulator of urea utilization, TetR family
Transcriptional regulator of urea utilization, TetR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD