Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog MntR - Clostridia-1

Properties
Regulator type: Transcription factor
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Clostridium acetobutylicum ATCC 824 1 1
Clostridium beijerincki NCIMB 8052 2 2
Clostridium botulinum A str. ATCC 3502
Clostridium butyricum 5521
Clostridium kluyveri DSM 555
Clostridium novyi NT 3 2
Clostridium perfringens ATCC 13124
Clostridium tetani E88
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
mntH
*
Clostridium acetobutylicum ATCC 824

Site:
position = -78
score = 6.17018
sequence = AAATTTAGTTTAATCTAACTTT

Gene: CAP0063: Manganese transport protein, NRAMP family
*
Clostridium beijerincki NCIMB 8052

Site:
position = -109
score = 5.96712
sequence = TAATTTAGACTAGGCTAAGAAA

Gene: Cbei_4070: Manganese transport protein, NRAMP family
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Manganese transport protein, NRAMP family
 
CRON 2.
mntR
 
Clostridium acetobutylicum ATCC 824

Gene: CAC2616: Mn-dependent transcriptional regulator, DtxR family
*
Clostridium beijerincki NCIMB 8052

Site:
position = -133
score = 5.96712
sequence = TTTCTTAGCCTAGTCTAAATTA

Gene: Cbei_4069: Mn-dependent transcriptional regulator, DtxR family
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
*
Clostridium novyi NT

Site:
position = -164
score = 6.81199
sequence = AAAATTAGCTTAGTCTAACTTT

Gene: NT01CX_2309: Mn-dependent transcriptional regulator, DtxR family
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Mn-dependent transcriptional regulator, DtxR family
 
CRON 3.
feoA
 
Clostridium acetobutylicum ATCC 824
 2
Clostridium beijerincki NCIMB 8052

Gene: Cbei_4198: Ferrous iron transport protein A

Gene: Cbei_4197: Ferrous iron transport protein A
 
Clostridium botulinum A str. ATCC 3502

Gene: CBO0816: Ferrous iron transport protein A
 
Clostridium butyricum 5521

Gene: CBY_3866: Ferrous iron transport protein A
 
Clostridium kluyveri DSM 555

Gene: CKL_0949: Ferrous iron transport protein A
*
Clostridium novyi NT

Site:
position = -65
score = 6.81199
sequence = AAAGTTAGACTAAGCTAATTTT

Gene: NT01CX_2308: Ferrous iron transport protein A
 
Clostridium perfringens ATCC 13124

Gene: CPF_1010: Ferrous iron transport protein A
 
Clostridium tetani E88
Ferrous iron transport protein A
feoB
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_4196: Ferrous iron transport protein B
 2
Clostridium botulinum A str. ATCC 3502

Gene: CBO0818: Ferrous iron transport protein B

Gene: CBO0817: Ferrous iron transport protein B
 
Clostridium butyricum 5521

Gene: CBY_3867: Ferrous iron transport protein B
 
Clostridium kluyveri DSM 555

Gene: CKL_0948: Ferrous iron transport protein B
 
Clostridium novyi NT

Gene: NT01CX_2307: Ferrous iron transport protein B
 
Clostridium perfringens ATCC 13124

Gene: CPF_1009: Ferrous iron transport protein B
 
Clostridium tetani E88
Ferrous iron transport protein B
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD