Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SdaR - Clostridia-1

Properties
Regulator type: Transcription factor
Regulator family: SdaR
Regulation mode: activator
Biological process: Glycerate utilization
Effector: D-glycerate
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Clostridium butyricum 5521 2 1
Clostridium acetobutylicum ATCC 824 3 1
Clostridium beijerincki NCIMB 8052 2 1
Clostridium botulinum A str. ATCC 3502
Clostridium kluyveri DSM 555
Clostridium novyi NT 2 1
Clostridium perfringens ATCC 13124 1 1
Clostridium tetani E88
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
grtP
*
Clostridium butyricum 5521

Site:
position = -120
score = 6.42725
sequence = AATTGTTCAAATGCACAAAA

Gene: CBY_1134: D-glycerate transporter, GntP family
*
Clostridium acetobutylicum ATCC 824

Site:
position = -119
score = 6.61032
sequence = TTTTGTGCAATTGAACAAAA

Gene: CAC2835: D-glycerate transporter, GntP family
*
Clostridium beijerincki NCIMB 8052

Site:
position = -152
score = 6.37481
sequence = TATTGTTCAAATACACAAAA

Gene: Cbei_4480: D-glycerate transporter, GntP family
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium kluyveri DSM 555
*
Clostridium novyi NT

Site:
position = -97
score = 6.37481
sequence = TATTGTGCATTTGAACAATA

Gene: NT01CX_0983: D-glycerate transporter, GntP family
*
Clostridium perfringens ATCC 13124

Site:
position = -135
score = 5.72073
sequence = CTTTGTGCGTTTGCATAAAG

Gene: CPF_0853: D-glycerate transporter, GntP family
 
Clostridium tetani E88

Gene: CTC00701: D-glycerate transporter, GntP family
D-glycerate transporter, GntP family
garK
 
Clostridium butyricum 5521

Gene: CBY_1133: Glycerate kinase (EC 2.7.1.31)
 
Clostridium acetobutylicum ATCC 824

Gene: CAC2834: Glycerate kinase (EC 2.7.1.31)
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_4479: Glycerate kinase (EC 2.7.1.31)
 
Clostridium botulinum A str. ATCC 3502

Gene: CBO2235: Glycerate kinase (EC 2.7.1.31)
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT

Gene: NT01CX_0984: Glycerate kinase (EC 2.7.1.31)
 
Clostridium perfringens ATCC 13124

Gene: CPF_0854: Glycerate kinase (EC 2.7.1.31)
 
Clostridium tetani E88

Gene: CTC00702: Glycerate kinase (EC 2.7.1.31)
Glycerate kinase (EC 2.7.1.31)
sdaR
 
Clostridium butyricum 5521

Gene: CBY_1135: Glycerate utilization transcriptional regulator SdaR, SdaR family
 
Clostridium acetobutylicum ATCC 824

Gene: CAC2833: Glycerate utilization transcriptional regulator SdaR, SdaR family
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_4476: Glycerate utilization transcriptional regulator SdaR, SdaR family
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT

Gene: NT01CX_0982: Glycerate utilization transcriptional regulator SdaR, SdaR family
 
Clostridium perfringens ATCC 13124

Gene: CPF_0851: Glycerate utilization transcriptional regulator SdaR, SdaR family
 
Clostridium tetani E88
Glycerate utilization transcriptional regulator SdaR, SdaR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD