Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog AmtR - Micrococcineae

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Nitrogen metabolism
Effector: GlnK-AMP, signal transduction protein
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Arthrobacter aurescens TC1 6 2
Arthrobacter chlorophenolicus A6
Arthrobacter sp. FB24 6 2
Beutenbergia cavernae DSM 12333
Brachybacterium faecium DSM 4810
Brevibacterium linens BL2
Clavibacter michiganensis subsp. michiganensis NCPPB 382 5 1
Janibacter sp. HTCC2649
Jonesia denitrificans DSM 20603
Kocuria rhizophila DC2201
Kytococcus sedentarius DSM 20547
Leifsonia xyli subsp. xyli str. CTCB07
Renibacterium salmoninarum ATCC 33209
Tropheryma whipplei str. Twist
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
uctT
*
Arthrobacter aurescens TC1

Site:
position = -90
score = 4.92434
sequence = GAAAACTATCAAGTGACCGATATT

Gene: AAur_0190: Urea carboxylase-related transporter, Amino acid permease family
 
Arthrobacter chlorophenolicus A6
*
Arthrobacter sp. FB24

Site:
position = -93
score = 4.83495
sequence = GAAAACTATCAAGTGACCGGTATT

Gene: Arth_3666: Urea carboxylase-related transporter, Amino acid permease family
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
*
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Site:
position = -87
score = 5.246
sequence = AATACCTATCGCTCGATAGATACT

Gene: CMM_0123: Urea carboxylase-related transporter, Amino acid permease family
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Urea carboxylase-related transporter, Amino acid permease family
amt1
 
Arthrobacter aurescens TC1

Gene: AAur_0189: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter sp. FB24

Gene: Arth_3667: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Gene: CMM_0122: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
amt2
 
Arthrobacter aurescens TC1

Gene: AAur_0188: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter sp. FB24

Gene: Arth_3668: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Gene: CMM_0121: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
ucaA
 
Arthrobacter aurescens TC1

Gene: AAur_0187: Urea carboxylase (EC 6.3.4.6)
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter sp. FB24

Gene: Arth_3669: Urea carboxylase (EC 6.3.4.6)
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Gene: CMM_0120: Urea carboxylase (EC 6.3.4.6)
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Urea carboxylase (EC 6.3.4.6)
amtR
*
Arthrobacter aurescens TC1

Site:
position = -162
score = 4.92434
sequence = AATATCGGTCACTTGATAGTTTTC

Gene: AAur_0192: Transcriptional regulator of urea utilization, TetR family
 
Arthrobacter chlorophenolicus A6
*
Arthrobacter sp. FB24

Site:
position = -163
score = 4.83495
sequence = AATACCGGTCACTTGATAGTTTTC

Gene: Arth_3665: Transcriptional regulator of urea utilization, TetR family
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Gene: CMM_0119: Transcriptional regulator of urea utilization, TetR family
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Transcriptional regulator of urea utilization, TetR family
ucaB
 
Arthrobacter aurescens TC1

Gene: AAur_0186: Allophanate hydrolase (EC 3.5.1.54)
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter sp. FB24

Gene: Arth_3670: Allophanate hydrolase (EC 3.5.1.54)
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Gene: CMM_2824: Allophanate hydrolase (EC 3.5.1.54)
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Allophanate hydrolase (EC 3.5.1.54)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD