Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SamR - Xanthomonadales

Properties
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Methionine metabolism
Effector: S-adenosylmethionine
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 17 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Stenotrophomonas maltophilia K279a 8 4
Xanthomonas axonopodis pv. citri str. 306 8 4
Xanthomonas campestris pv. campestris str. ATCC 33913 8 4
Xylella fastidiosa 9a5c 6 5
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
metE
 
Stenotrophomonas maltophilia K279a
 
Xanthomonas axonopodis pv. citri str. 306
 
Xanthomonas campestris pv. campestris str. ATCC 33913
*
Xylella fastidiosa 9a5c

Site:
position = -408
score = 5.67601
sequence = ATCGCTATATCTGGATGAAGCGAT

Gene: XF2272: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
 
CRON 2.
metF2
*
Stenotrophomonas maltophilia K279a

Site:
position = -58
score = 4.81521
sequence = AAGCATCCATCTTGATGAAGAGAT

Gene: Smlt0767: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -57
score = 5.46009
sequence = ATGCATTCATCGCGATGAAGCGAT

Gene: XAC0791: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -57
score = 5.46009
sequence = ATGCATTCATCGCGATGAAGCGAT

Gene: XCC0739: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
*
Xylella fastidiosa 9a5c

Site:
position = -55
score = 5.02594
sequence = TCACATTCATCCGGATGAAGAGAT

Gene: XF1121: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
CRON 3.
metX2
*
Stenotrophomonas maltophilia K279a

Site:
position = -252
score = 6.21311
sequence = ATCGCTTTATCCGCATGAAGGGAT

Gene: Smlt3635: Homoserine O-acetyltransferase (EC 2.3.1.31)
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -247
score = 6.84174
sequence = ATCTTTCCATCCGCATGAAGAGAT

Gene: XAC3040: Homoserine O-acetyltransferase (EC 2.3.1.31)
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -248
score = 6.84174
sequence = ATCTTTCCATCCGCATGAAGAGAT

Gene: XCC2857: Homoserine O-acetyltransferase (EC 2.3.1.31)
*
Xylella fastidiosa 9a5c

Site:
position = -249
score = 6.6664
sequence = ATCTTTCTATCCGTATGGAGAGAT

Gene: XF0863: Homoserine O-acetyltransferase (EC 2.3.1.31)
Homoserine O-acetyltransferase (EC 2.3.1.31)
metB
 
Stenotrophomonas maltophilia K279a

Gene: Smlt3634: Cystathionine gamma-synthase (EC 2.5.1.48)
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC3039: Cystathionine gamma-synthase (EC 2.5.1.48)
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC2856: Cystathionine gamma-synthase (EC 2.5.1.48)
 
Xylella fastidiosa 9a5c

Gene: XF0864: Cystathionine gamma-synthase (EC 2.5.1.48)
Cystathionine gamma-synthase (EC 2.5.1.48)
hom
 
Stenotrophomonas maltophilia K279a

Gene: Smlt3633: Homoserine dehydrogenase (EC 1.1.1.3)
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC3038: Homoserine dehydrogenase (EC 1.1.1.3)
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC2855: Homoserine dehydrogenase (EC 1.1.1.3)
 
Xylella fastidiosa 9a5c
Homoserine dehydrogenase (EC 1.1.1.3)
 
CRON 4.
metK
*
Stenotrophomonas maltophilia K279a

Site:
position = -34
score = 6.46964
sequence = ATCTTTCCATCCGAATCAAGGGAT

Gene: Smlt0780: S-adenosylmethionine synthetase (EC 2.5.1.6)
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -33
score = 6.65911
sequence = ATCTTTTCATCCGAATTAAGGGAT

Gene: XAC0813: S-adenosylmethionine synthetase (EC 2.5.1.6)
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -33
score = 6.65911
sequence = ATCTTTTCATCCGAATTAAGGGAT

Gene: XCC0761: S-adenosylmethionine synthetase (EC 2.5.1.6)
*
Xylella fastidiosa 9a5c

Site:
position = -33
score = 6.52762
sequence = ATCTTTTCATTCGAATTAAGGGAT

Gene: XF0392: S-adenosylmethionine synthetase (EC 2.5.1.6)
S-adenosylmethionine synthetase (EC 2.5.1.6)
 
CRON 5.
samR
*
Stenotrophomonas maltophilia K279a

Site:
position = -28
score = 6.02334
sequence = ATCTCTATATCGCGATAGGTAGAT

Gene: Smlt3175: Transcriptional regulator of methionine metabolism, ArsR family
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -28
score = 6.2964
sequence = ATCTCCATATCGCGATATAGAGAT

Gene: XAC1561: Transcriptional regulator of methionine metabolism, ArsR family
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = 29
score = 6.2964
sequence = ATCTCCATATCGCGATATAGAGAT

Gene: XCC1513: Transcriptional regulator of methionine metabolism, ArsR family
*
Xylella fastidiosa 9a5c

Site:
position = -28
score = 5.84316
sequence = ATCTCTGTATCGAGATATAGACAT

Gene: XF1617: Transcriptional regulator of methionine metabolism, ArsR family
Transcriptional regulator of methionine metabolism, ArsR family
metH2
 
Stenotrophomonas maltophilia K279a

Gene: Smlt3176: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC1560: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC1512: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
Xylella fastidiosa 9a5c
5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
metH1
 
Stenotrophomonas maltophilia K279a

Gene: Smlt3177: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC1559: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC1511: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
Xylella fastidiosa 9a5c
5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD