Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SdhR - Comamonadaceae

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Tricarboxylic acid cycle
Effector:
Phylum: Proteobacteria/Beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 36 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Acidovorax avenae subsp. citrulli AAC00-1 13 3
Acidovorax sp. JS42 13 3
Comamonas testosteroni KF-1 13 3
Delftia acidovorans SPH-1 13 3
Leptothrix cholodnii SP-6 11 4
Methylibium petroleiphilum PM1 10 3
Polaromonas naphthalenivorans CJ2 12 3
Polaromonas sp. JS666 12 3
Rhodoferax ferrireducens DSM 15236 12 3
Variovorax paradoxus S110 13 3
Verminephrobacter eiseniae EF01-2 9 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
sdhR
*
Acidovorax avenae subsp. citrulli AAC00-1

Site:
position = -20
score = 7.03683
sequence = TCTTATGTCTTATATAAGATATGATG

Gene: Aave_2205: Transcriptional regulator of TCA cycle, GntR family
*
Acidovorax sp. JS42

Site:
position = -4
score = 7.23905
sequence = TCTTATGTCTTATATAAGATATGATC

Gene: Ajs_2792: Transcriptional regulator of TCA cycle, GntR family
*
Comamonas testosteroni KF-1

Site:
position = -4
score = 7.23905
sequence = TCTTATGTCTTATATAAGATATGATC

Gene: CtesDRAFT_0621: Transcriptional regulator of TCA cycle, GntR family
*
Delftia acidovorans SPH-1

Site:
position = -87
score = 7.23905
sequence = TCTTATGTCTTATATAAGATATGATC

Gene: Daci_2428: Transcriptional regulator of TCA cycle, GntR family
*
Leptothrix cholodnii SP-6

Site:
position = -73
score = 7.52066
sequence = TCTTATGTCTTATATAAGACATCTGT

Gene: Lcho_2707: Transcriptional regulator of TCA cycle, GntR family
*
Methylibium petroleiphilum PM1

Site:
position = -74
score = 7.372
sequence = TCTTATGTCTTATATAAGACATCTTT

Gene: Mpe_A2171: Transcriptional regulator of TCA cycle, GntR family
*
Polaromonas naphthalenivorans CJ2

Site:
position = -38
score = 7.3504
sequence = TCTTATGTCTTATATAAGATATGATT

Gene: Pnap_3031: Transcriptional regulator of TCA cycle, GntR family
*
Polaromonas sp. JS666

Site:
position = -49
score = 7.4713
sequence = TCTTATGTCTTATATAAGATATGATA

Gene: Bpro_3599: Transcriptional regulator of TCA cycle, GntR family
*
Rhodoferax ferrireducens DSM 15236

Site:
position = -23
score = 6.72716
sequence = TCTTATGTCTTATATAAGATAAGATG

Gene: Rfer_1802: Transcriptional regulator of TCA cycle, GntR family
*
Variovorax paradoxus S110

Site:
position = -4
score = 6.80457
sequence = TCTTATGTCTTATATAAGATATGCTC

Gene: Vapar_1431: Transcriptional regulator of TCA cycle, GntR family
*
Verminephrobacter eiseniae EF01-2

Site:
position = -33
score = 7.23905
sequence = TCTTATGTCTTATATAAGATATGATC

Gene: Veis_4355: Transcriptional regulator of TCA cycle, GntR family
Transcriptional regulator of TCA cycle, GntR family
sdhC
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_2204: Succinate dehydrogenase cytochrome b-556 subunit
 
Acidovorax sp. JS42

Gene: Ajs_2793: Succinate dehydrogenase cytochrome b-556 subunit
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_0620: Succinate dehydrogenase cytochrome b-556 subunit
 
Delftia acidovorans SPH-1

Gene: Daci_2427: Succinate dehydrogenase cytochrome b-556 subunit
 
Leptothrix cholodnii SP-6

Gene: Lcho_2706: Succinate dehydrogenase cytochrome b-556 subunit
 
Methylibium petroleiphilum PM1

Gene: Mpe_A2170: Succinate dehydrogenase cytochrome b-556 subunit
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_3032: Succinate dehydrogenase cytochrome b-556 subunit
 
Polaromonas sp. JS666

Gene: Bpro_3600: Succinate dehydrogenase cytochrome b-556 subunit
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_1801: Succinate dehydrogenase cytochrome b-556 subunit
 
Variovorax paradoxus S110

Gene: Vapar_1430: Succinate dehydrogenase cytochrome b-556 subunit
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_4354: Succinate dehydrogenase cytochrome b-556 subunit
Succinate dehydrogenase cytochrome b-556 subunit
sdhD
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_2203: Succinate dehydrogenase hydrophobic membrane anchor protein
 
Acidovorax sp. JS42

Gene: Ajs_2794: Succinate dehydrogenase hydrophobic membrane anchor protein
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_0619: Succinate dehydrogenase hydrophobic membrane anchor protein
 
Delftia acidovorans SPH-1

Gene: Daci_2426: Succinate dehydrogenase hydrophobic membrane anchor protein
 
Leptothrix cholodnii SP-6

Gene: Lcho_2705: Succinate dehydrogenase hydrophobic membrane anchor protein
 
Methylibium petroleiphilum PM1

Gene: Mpe_A2169: Succinate dehydrogenase hydrophobic membrane anchor protein
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_3033: Succinate dehydrogenase hydrophobic membrane anchor protein
 
Polaromonas sp. JS666

Gene: Bpro_3601: Succinate dehydrogenase hydrophobic membrane anchor protein
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_1800: Succinate dehydrogenase hydrophobic membrane anchor protein
 
Variovorax paradoxus S110

Gene: Vapar_1429: Succinate dehydrogenase hydrophobic membrane anchor protein
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_4353: Succinate dehydrogenase hydrophobic membrane anchor protein
Succinate dehydrogenase hydrophobic membrane anchor protein
sdhA
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_2202: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1)
 
Acidovorax sp. JS42

Gene: Ajs_2795: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1)
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_0618: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1)
 
Delftia acidovorans SPH-1

Gene: Daci_2425: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1)
 
Leptothrix cholodnii SP-6

Gene: Lcho_2704: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1)
 
Methylibium petroleiphilum PM1

Gene: Mpe_A2168: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1)
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_3034: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1)
 
Polaromonas sp. JS666

Gene: Bpro_3602: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1)
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_1799: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1)
 
Variovorax paradoxus S110

Gene: Vapar_1428: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1)
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_4352: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1)
Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1)
sdhB
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_2201: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
 
Acidovorax sp. JS42

Gene: Ajs_2796: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_0617: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
 
Delftia acidovorans SPH-1

Gene: Daci_2424: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
 
Leptothrix cholodnii SP-6

Gene: Lcho_2703: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
 
Methylibium petroleiphilum PM1

Gene: Mpe_A2167: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_3035: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
 
Polaromonas sp. JS666

Gene: Bpro_3603: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_1798: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
 
Variovorax paradoxus S110

Gene: Vapar_1427: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_4351: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
COG2938
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_2200: succinate dehydrogenase iron-sulfur subunit
 
Acidovorax sp. JS42

Gene: Ajs_2797: succinate dehydrogenase iron-sulfur subunit
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_0616: succinate dehydrogenase iron-sulfur subunit
 
Delftia acidovorans SPH-1

Gene: Daci_2423: succinate dehydrogenase iron-sulfur subunit
 
Leptothrix cholodnii SP-6

Gene: Lcho_2702: succinate dehydrogenase iron-sulfur subunit
 
Methylibium petroleiphilum PM1

Gene: Mpe_A2166: succinate dehydrogenase iron-sulfur subunit
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_3036: succinate dehydrogenase iron-sulfur subunit
 
Polaromonas sp. JS666

Gene: Bpro_3604: succinate dehydrogenase iron-sulfur subunit
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_1797: succinate dehydrogenase iron-sulfur subunit
 
Variovorax paradoxus S110

Gene: Vapar_1426: succinate dehydrogenase iron-sulfur subunit
 
Verminephrobacter eiseniae EF01-2
succinate dehydrogenase iron-sulfur subunit
gltA
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_2199: Citrate synthase (si) (EC 2.3.3.1)
 
Acidovorax sp. JS42

Gene: Ajs_2798: Citrate synthase (si) (EC 2.3.3.1)
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_0615: Citrate synthase (si) (EC 2.3.3.1)
 
Delftia acidovorans SPH-1

Gene: Daci_2422: Citrate synthase (si) (EC 2.3.3.1)
 
Leptothrix cholodnii SP-6

Gene: Lcho_2701: Citrate synthase (si) (EC 2.3.3.1)
 
Methylibium petroleiphilum PM1

Gene: Mpe_A2165: Citrate synthase (si) (EC 2.3.3.1)
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_3037: Citrate synthase (si) (EC 2.3.3.1)
 
Polaromonas sp. JS666

Gene: Bpro_3605: Citrate synthase (si) (EC 2.3.3.1)
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_1796: Citrate synthase (si) (EC 2.3.3.1)
 
Variovorax paradoxus S110

Gene: Vapar_1425: Citrate synthase (si) (EC 2.3.3.1)
 2
Verminephrobacter eiseniae EF01-2

Gene: Veis_1400: Citrate synthase (si) (EC 2.3.3.1)

Gene: Veis_4350: Citrate synthase (si) (EC 2.3.3.1)
Citrate synthase (si) (EC 2.3.3.1)
 
CRON 2.
aceA
*
Acidovorax avenae subsp. citrulli AAC00-1

Site:
position = -115
score = 7.52667
sequence = TTTTATGTCTTATATAAGACATAAGA

Gene: Aave_2860: Isocitrate lyase (EC 4.1.3.1)
*
Acidovorax sp. JS42

Site:
position = -115
score = 6.94881
sequence = ATTTATCTCTTATATAAGACATAAGA

Gene: Ajs_2401: Isocitrate lyase (EC 4.1.3.1)
*
Comamonas testosteroni KF-1

Site:
position = -109
score = 6.11808
sequence = ATTTCAGTCTTTTATAAGACATAAGA

Gene: CtesDRAFT_0860: Isocitrate lyase (EC 4.1.3.1)
*
Delftia acidovorans SPH-1

Site:
position = -1
score = 5.30837
sequence = GATGAGGTCTTCTATAAGACTTAAAT

Site:
position = -31
score = 5.94397
sequence = AATTTAGTCTTGTATAAGACACAAGA

Gene: Daci_4617: Isocitrate lyase (EC 4.1.3.1)
*
Leptothrix cholodnii SP-6

Site:
position = -102
score = 7.12546
sequence = ATTTATATCTTATATAAGACATAAGT

Gene: Lcho_1744: Isocitrate lyase (EC 4.1.3.1)
*
Methylibium petroleiphilum PM1

Site:
position = -103
score = 5.99547
sequence = ATAGAAGTCTTATATAAGATAGAAGT

Gene: Mpe_A1889: Isocitrate lyase (EC 4.1.3.1)
*
Polaromonas naphthalenivorans CJ2

Site:
position = -91
score = 6.49199
sequence = TAAATAGTCTTATATAAGACATAAGA

Gene: Pnap_2855: Isocitrate lyase (EC 4.1.3.1)
*
Polaromonas sp. JS666

Site:
position = -102
score = 7.0961
sequence = ATTTTTGTCTTATATAAGACATAAGA

Gene: Bpro_2101: Isocitrate lyase (EC 4.1.3.1)
*
Rhodoferax ferrireducens DSM 15236

Site:
position = -124
score = 6.68077
sequence = AAAAATGTCTTCTATAAGACATAAGA

Site:
position = -94
score = 5.30377
sequence = TTTTTAGTCTTATACAAGACCTAAAA

Gene: Rfer_1335: Isocitrate lyase (EC 4.1.3.1)
*
Variovorax paradoxus S110

Site:
position = -97
score = 7.13245
sequence = AAATATGTCTTCTATAAGACATAAGA

Gene: Vapar_1869: Isocitrate lyase (EC 4.1.3.1)
*
Verminephrobacter eiseniae EF01-2

Site:
position = -116
score = 6.38721
sequence = TTTCATCTCTTCTATAAGACATAAGA

Gene: Veis_3088: Isocitrate lyase (EC 4.1.3.1)
Isocitrate lyase (EC 4.1.3.1)
 
CRON 3.
mdh
*
Acidovorax avenae subsp. citrulli AAC00-1

Site:
position = -156
score = 7.03683
sequence = CATCATATCTTATATAAGACATAAGA

Gene: Aave_2206: Malate dehydrogenase (EC 1.1.1.37)
*
Acidovorax sp. JS42

Site:
position = -91
score = 7.23905
sequence = GATCATATCTTATATAAGACATAAGA

Gene: Ajs_2791: Malate dehydrogenase (EC 1.1.1.37)
*
Comamonas testosteroni KF-1

Site:
position = -155
score = 7.23905
sequence = GATCATATCTTATATAAGACATAAGA

Gene: CtesDRAFT_0622: Malate dehydrogenase (EC 1.1.1.37)
*
Delftia acidovorans SPH-1

Site:
position = -157
score = 7.23905
sequence = GATCATATCTTATATAAGACATAAGA

Gene: Daci_2429: Malate dehydrogenase (EC 1.1.1.37)
*
Leptothrix cholodnii SP-6

Site:
position = -175
score = 7.52066
sequence = ACAGATGTCTTATATAAGACATAAGA

Gene: Lcho_2708: Malate dehydrogenase (EC 1.1.1.37)
*
Methylibium petroleiphilum PM1

Site:
position = -152
score = 7.372
sequence = AAAGATGTCTTATATAAGACATAAGA

Gene: Mpe_A2172: Malate dehydrogenase (EC 1.1.1.37)
*
Polaromonas naphthalenivorans CJ2

Site:
position = -202
score = 7.3504
sequence = AATCATATCTTATATAAGACATAAGA

Gene: Pnap_3030: Malate dehydrogenase (EC 1.1.1.37)
*
Polaromonas sp. JS666

Site:
position = -239
score = 7.4713
sequence = TATCATATCTTATATAAGACATAAGA

Gene: Bpro_3598: Malate dehydrogenase (EC 1.1.1.37)
*
Rhodoferax ferrireducens DSM 15236

Site:
position = -138
score = 6.72716
sequence = CATCTTATCTTATATAAGACATAAGA

Gene: Rfer_1803: Malate dehydrogenase (EC 1.1.1.37)
*
Variovorax paradoxus S110

Site:
position = -151
score = 6.80457
sequence = GAGCATATCTTATATAAGACATAAGA

Gene: Vapar_1432: Malate dehydrogenase (EC 1.1.1.37)
*
Verminephrobacter eiseniae EF01-2

Site:
position = -199
score = 7.23905
sequence = GATCATATCTTATATAAGACATAAGA

Gene: Veis_4356: Malate dehydrogenase (EC 1.1.1.37)
Malate dehydrogenase (EC 1.1.1.37)
tam
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_2207: Trans-aconitate 2-methyltransferase (EC 2.1.1.144)
 
Acidovorax sp. JS42

Gene: Ajs_2790: Trans-aconitate 2-methyltransferase (EC 2.1.1.144)
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_0623: Trans-aconitate 2-methyltransferase (EC 2.1.1.144)
 2
Delftia acidovorans SPH-1

Gene: Daci_3508: Trans-aconitate 2-methyltransferase (EC 2.1.1.144)

Gene: Daci_2430: Trans-aconitate 2-methyltransferase (EC 2.1.1.144)
 
Leptothrix cholodnii SP-6
 
Methylibium petroleiphilum PM1
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_2675: Trans-aconitate 2-methyltransferase (EC 2.1.1.144)
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110

Gene: Vapar_1433: Trans-aconitate 2-methyltransferase (EC 2.1.1.144)
 
Verminephrobacter eiseniae EF01-2
Trans-aconitate 2-methyltransferase (EC 2.1.1.144)
citE
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_2208: Citrate lyase beta chain (EC 4.1.3.6)
 
Acidovorax sp. JS42

Gene: Ajs_2789: Citrate lyase beta chain (EC 4.1.3.6)
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_0624: Citrate lyase beta chain (EC 4.1.3.6)
 
Delftia acidovorans SPH-1

Gene: Daci_2431: Citrate lyase beta chain (EC 4.1.3.6)
 
Leptothrix cholodnii SP-6

Gene: Lcho_2709: Citrate lyase beta chain (EC 4.1.3.6)
 
Methylibium petroleiphilum PM1

Gene: Mpe_A2173: Citrate lyase beta chain (EC 4.1.3.6)
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_3029: Citrate lyase beta chain (EC 4.1.3.6)
 
Polaromonas sp. JS666

Gene: Bpro_3597: Citrate lyase beta chain (EC 4.1.3.6)
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_1804: Citrate lyase beta chain (EC 4.1.3.6)
 
Variovorax paradoxus S110

Gene: Vapar_1434: Citrate lyase beta chain (EC 4.1.3.6)
 
Verminephrobacter eiseniae EF01-2
Citrate lyase beta chain (EC 4.1.3.6)
Aave_2209
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_2209: hypothetical protein
 
Acidovorax sp. JS42

Gene: Ajs_2788: hypothetical protein
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_0625: hypothetical protein
 
Delftia acidovorans SPH-1

Gene: Daci_2432: hypothetical protein
 
Leptothrix cholodnii SP-6

Gene: Lcho_2710: hypothetical protein
 
Methylibium petroleiphilum PM1

Gene: Mpe_A1366: hypothetical protein
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_3028: hypothetical protein
 
Polaromonas sp. JS666

Gene: Bpro_3596: hypothetical protein
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_1805: hypothetical protein
 
Variovorax paradoxus S110

Gene: Vapar_1435: hypothetical protein
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_4357: hypothetical protein
hypothetical protein
acnB
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_2210: Aconitate hydratase (EC 4.2.1.3)
 
Acidovorax sp. JS42

Gene: Ajs_2787: Aconitate hydratase (EC 4.2.1.3)
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_0626: Aconitate hydratase (EC 4.2.1.3)
 
Delftia acidovorans SPH-1

Gene: Daci_2433: Aconitate hydratase (EC 4.2.1.3)
*
Leptothrix cholodnii SP-6

Site:
position = -114
score = 6.12548
sequence = TGGCAAGTCTTATATAAGACATAAAA

Gene: Lcho_2711: Aconitate hydratase (EC 4.2.1.3)
 
Methylibium petroleiphilum PM1

Gene: Mpe_A1363: Aconitate hydratase (EC 4.2.1.3)
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_3027: Aconitate hydratase (EC 4.2.1.3)
 
Polaromonas sp. JS666

Gene: Bpro_3595: Aconitate hydratase (EC 4.2.1.3)
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_1806: Aconitate hydratase (EC 4.2.1.3)
 
Variovorax paradoxus S110

Gene: Vapar_1436: Aconitate hydratase (EC 4.2.1.3)
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_4358: Aconitate hydratase (EC 4.2.1.3)
Aconitate hydratase (EC 4.2.1.3)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD