Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog TsrR - Shewanellaceae

Properties
Regulator type: Transcription factor
Regulator family: [Other]
Regulation mode:
Biological process: Thiosulfate reduction
Effector: Thiosulfate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 40 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Shewanella amazonensis SB2B
Shewanella baltica OS155
Shewanella denitrificans OS217
Shewanella frigidimarina NCIMB 400
Shewanella halifaxensis HAW-EB4 25 3
Shewanella loihica PV-4 14 2
Shewanella oneidensis MR-1 14 2
Shewanella pealeana ATCC 700345 25 3
Shewanella piezotolerans WP3 14 2
Shewanella putrefaciens CN-32 12 2
Shewanella sediminis HAW-EB3 25 3
Shewanella sp ANA-3 9 2
Shewanella sp MR-4 14 2
Shewanella sp MR-7 14 2
Shewanella sp W3-18-1 12 2
Shewanella woodyi ATCC 51908 25 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
tsrA
 
Shewanella amazonensis SB2B
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
*2
Shewanella halifaxensis HAW-EB4

Site:
position = -287
score = 4.73586
sequence = CTTTTTTGCGATTCAAAAAACG

Site:
position = -257
score = 6.03197
sequence = TGATTTTTATATCTAAAAAGAT

Gene: Shal_0567: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA

Site:
position = -263
score = 5.52002
sequence = ATCCTTTTAGATGTCAAAAGGT

Gene: Shal_0551: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
*
Shewanella loihica PV-4

Site:
position = -320
score = 5.37216
sequence = TATTTTTCATAACTCAAAAAGC

Site:
position = -290
score = 6.20201
sequence = CTTTTTTGAGATCTAAAAATGC

Gene: Shew_0348: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
*
Shewanella oneidensis MR-1

Site:
position = -250
score = 6.87076
sequence = GTTTTTTTAGATCTAAAAAAAC

Gene: SO0479: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
*2
Shewanella pealeana ATCC 700345

Site:
position = -259
score = 6.03197
sequence = TGATTTTTATATCTAAAAAGAT

Site:
position = -289
score = 5.355
sequence = CTTTTTTGCGATTTAAAAAACG

Gene: Spea_0503: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA

Site:
position = -264
score = 6.31096
sequence = GTCTTTTTAGATATCAAAAAAT

Site:
position = -262
score = 4.79101
sequence = CTTTTTAGATATCAAAAAATGC

Gene: Spea_0479: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
*
Shewanella piezotolerans WP3

Site:
position = -366
score = 6.4489
sequence = CTTTTTTTAGATCTAAAAATAA

Gene: swp_4657: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
*
Shewanella putrefaciens CN-32

Site:
position = -253
score = 5.77197
sequence = TTTTTTTTATAACTAAAACAGG

Site:
position = -232
score = 5.98059
sequence = GCTTTTTTACTTCTAAAAAACA

Gene: Sputcn32_3364: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
*2
Shewanella sediminis HAW-EB3

Site:
position = -254
score = 6.12805
sequence = ATCCTTTTAGATCTAAAAAACA

Gene: Ssed_0482: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA

Site:
position = -256
score = 5.26264
sequence = CGATTTTTATTTCTAAAATGAT

Site:
position = -132
score = 4.9448
sequence = TGTTTTTTATATGGAAAATAGA

Gene: Ssed_0493: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
*
Shewanella sp ANA-3

Site:
position = -253
score = 6.44135
sequence = CTCTTTTTAGATCTAAAAAGCC

Gene: Shewana3_0489: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
*
Shewanella sp MR-4

Site:
position = -253
score = 6.4162
sequence = GTCTTTTTATATCTCAAAAAAC

Gene: Shewmr4_0488: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
*
Shewanella sp MR-7

Site:
position = -253
score = 6.44938
sequence = GTCTTTTTAGATCTCAAAAACC

Gene: Shewmr7_3542: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
*
Shewanella sp W3-18-1

Site:
position = -253
score = 5.77197
sequence = TTTTTTTTATAACTAAAACAGG

Site:
position = -232
score = 5.98059
sequence = GCTTTTTTACTTCTAAAAAACA

Gene: Sputw3181_0577: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
*2
Shewanella woodyi ATCC 51908

Site:
position = -258
score = 5.82181
sequence = CAGTTTTTAGATCTAAAAAATC

Site:
position = -134
score = 4.91542
sequence = TGTTTTTTATATGGAAAATACT

Gene: Swoo_4456: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA

Site:
position = -265
score = 5.73365
sequence = AACCTTTTAGATATCAAAAAAC

Gene: Swoo_4477: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
tsrB
 
Shewanella amazonensis SB2B
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 2
Shewanella halifaxensis HAW-EB4

Gene: Shal_0568: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB

Gene: Shal_0552: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
 
Shewanella loihica PV-4

Gene: Shew_0349: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
 
Shewanella oneidensis MR-1

Gene: SO0480: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
 2
Shewanella pealeana ATCC 700345

Gene: Spea_0480: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB

Gene: Spea_0504: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
 
Shewanella piezotolerans WP3

Gene: swp_4656: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_3363: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
 2
Shewanella sediminis HAW-EB3

Gene: Ssed_0483: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB

Gene: Ssed_0494: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
 
Shewanella sp ANA-3

Gene: Shewana3_0490: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
 
Shewanella sp MR-4

Gene: Shewmr4_0489: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
 
Shewanella sp MR-7

Gene: Shewmr7_3541: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
 
Shewanella sp W3-18-1

Gene: Sputw3181_0578: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
 2
Shewanella woodyi ATCC 51908

Gene: Swoo_4476: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB

Gene: Swoo_4455: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
tsrC
 
Shewanella amazonensis SB2B
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 2
Shewanella halifaxensis HAW-EB4

Gene: Shal_0569: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase

Gene: Shal_0553: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
 
Shewanella loihica PV-4

Gene: Shew_0350: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
 
Shewanella oneidensis MR-1

Gene: SO0481: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
 2
Shewanella pealeana ATCC 700345

Gene: Spea_0481: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase

Gene: Spea_0505: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
 
Shewanella piezotolerans WP3

Gene: swp_4655: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_3362: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
 2
Shewanella sediminis HAW-EB3

Gene: Ssed_0484: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase

Gene: Ssed_0495: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
 
Shewanella sp ANA-3

Gene: Shewana3_0491: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
 
Shewanella sp MR-4

Gene: Shewmr4_0490: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
 
Shewanella sp MR-7

Gene: Shewmr7_3540: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
 
Shewanella sp W3-18-1

Gene: Sputw3181_0579: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
 2
Shewanella woodyi ATCC 51908

Gene: Swoo_4454: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase

Gene: Swoo_4475: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
tsrD
 
Shewanella amazonensis SB2B
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 2
Shewanella halifaxensis HAW-EB4

Gene: Shal_0570: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase

Gene: Shal_0554: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
 
Shewanella loihica PV-4

Gene: Shew_0351: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
 
Shewanella oneidensis MR-1

Gene: SO0482: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
 2
Shewanella pealeana ATCC 700345

Gene: Spea_0482: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase

Gene: Spea_0506: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
 
Shewanella piezotolerans WP3

Gene: swp_4654: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_3361: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
 2
Shewanella sediminis HAW-EB3

Gene: Ssed_0496: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase

Gene: Ssed_0485: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
 
Shewanella sp ANA-3

Gene: Shewana3_0492: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
 
Shewanella sp MR-4

Gene: Shewmr4_0491: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
 
Shewanella sp MR-7

Gene: Shewmr7_3539: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
 
Shewanella sp W3-18-1

Gene: Sputw3181_0580: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
 2
Shewanella woodyi ATCC 51908

Gene: Swoo_4474: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase

Gene: Swoo_4453: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
tsrE
 
Shewanella amazonensis SB2B
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 2
Shewanella halifaxensis HAW-EB4

Gene: Shal_0571: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE

Gene: Shal_0555: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE
 
Shewanella loihica PV-4

Gene: Shew_0352: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE
 
Shewanella oneidensis MR-1

Gene: SO0483: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE
 2
Shewanella pealeana ATCC 700345

Gene: Spea_0483: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE

Gene: Spea_0507: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE
 
Shewanella piezotolerans WP3

Gene: swp_4653: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE
 
Shewanella putrefaciens CN-32
 2
Shewanella sediminis HAW-EB3

Gene: Ssed_0486: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE

Gene: Ssed_0497: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE
 
Shewanella sp ANA-3

Gene: Shewana3_0493: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE
 
Shewanella sp MR-4

Gene: Shewmr4_0492: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE
 
Shewanella sp MR-7

Gene: Shewmr7_3538: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE
 
Shewanella sp W3-18-1
 2
Shewanella woodyi ATCC 51908

Gene: Swoo_4452: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE

Gene: Swoo_4473: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE
Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE
tsrF
 
Shewanella amazonensis SB2B
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 2
Shewanella halifaxensis HAW-EB4

Gene: Shal_0556: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF

Gene: Shal_0572: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF
 
Shewanella loihica PV-4

Gene: Shew_0353: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF
 
Shewanella oneidensis MR-1

Gene: SO0484: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF
 2
Shewanella pealeana ATCC 700345

Gene: Spea_0484: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF

Gene: Spea_0508: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF
 
Shewanella piezotolerans WP3

Gene: swp_4652: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF
 
Shewanella putrefaciens CN-32
 2
Shewanella sediminis HAW-EB3

Gene: Ssed_0487: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF

Gene: Ssed_0498: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF
 
Shewanella sp ANA-3

Gene: Shewana3_0494: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF
 
Shewanella sp MR-4

Gene: Shewmr4_0493: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF
 
Shewanella sp MR-7

Gene: Shewmr7_3537: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF
 
Shewanella sp W3-18-1
 2
Shewanella woodyi ATCC 51908

Gene: Swoo_4451: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF

Gene: Swoo_4472: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF
Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF
tsrG
 
Shewanella amazonensis SB2B
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 2
Shewanella halifaxensis HAW-EB4

Gene: Shal_0557: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG

Gene: Shal_0573: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG
 
Shewanella loihica PV-4

Gene: Shew_0354: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG
 
Shewanella oneidensis MR-1

Gene: SO0485: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG
 2
Shewanella pealeana ATCC 700345

Gene: Spea_0485: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG

Gene: Spea_0509: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG
 
Shewanella piezotolerans WP3

Gene: swp_4651: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_3360: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG
 2
Shewanella sediminis HAW-EB3

Gene: Ssed_0488: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG

Gene: Ssed_0499: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG
 
Shewanella sp ANA-3
 
Shewanella sp MR-4

Gene: Shewmr4_0494: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG
 
Shewanella sp MR-7

Gene: Shewmr7_3536: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG
 
Shewanella sp W3-18-1

Gene: Sputw3181_0581: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG
 2
Shewanella woodyi ATCC 51908

Gene: Swoo_4471: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG

Gene: Swoo_4450: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG
Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG
tsrH
 
Shewanella amazonensis SB2B
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 2
Shewanella halifaxensis HAW-EB4

Gene: Shal_0558: Predicted thiosulfate respiratory reductase maturation protein TsrH

Gene: Shal_0574: Predicted thiosulfate respiratory reductase maturation protein TsrH
 
Shewanella loihica PV-4

Gene: Shew_0355: Predicted thiosulfate respiratory reductase maturation protein TsrH
 
Shewanella oneidensis MR-1

Gene: SO0486: Predicted thiosulfate respiratory reductase maturation protein TsrH
 2
Shewanella pealeana ATCC 700345

Gene: Spea_0486: Predicted thiosulfate respiratory reductase maturation protein TsrH

Gene: Spea_0510: Predicted thiosulfate respiratory reductase maturation protein TsrH
 
Shewanella piezotolerans WP3

Gene: swp_4649: Predicted thiosulfate respiratory reductase maturation protein TsrH
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_3359: Predicted thiosulfate respiratory reductase maturation protein TsrH
 2
Shewanella sediminis HAW-EB3

Gene: Ssed_0500: Predicted thiosulfate respiratory reductase maturation protein TsrH

Gene: Ssed_0489: Predicted thiosulfate respiratory reductase maturation protein TsrH
 
Shewanella sp ANA-3

Gene: Shewana3_0496: Predicted thiosulfate respiratory reductase maturation protein TsrH
 
Shewanella sp MR-4

Gene: Shewmr4_0495: Predicted thiosulfate respiratory reductase maturation protein TsrH
 
Shewanella sp MR-7

Gene: Shewmr7_3535: Predicted thiosulfate respiratory reductase maturation protein TsrH
 
Shewanella sp W3-18-1

Gene: Sputw3181_0582: Predicted thiosulfate respiratory reductase maturation protein TsrH
 2
Shewanella woodyi ATCC 51908

Gene: Swoo_4449: Predicted thiosulfate respiratory reductase maturation protein TsrH

Gene: Swoo_4470: Predicted thiosulfate respiratory reductase maturation protein TsrH
Predicted thiosulfate respiratory reductase maturation protein TsrH
tsrI
 
Shewanella amazonensis SB2B
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 2
Shewanella halifaxensis HAW-EB4

Gene: Shal_0575: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)

Gene: Shal_0559: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
 
Shewanella loihica PV-4

Gene: Shew_0356: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
 
Shewanella oneidensis MR-1

Gene: SO0487: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
 2
Shewanella pealeana ATCC 700345

Gene: Spea_0487: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)

Gene: Spea_0511: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
 
Shewanella piezotolerans WP3

Gene: swp_4648: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_3358: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
 2
Shewanella sediminis HAW-EB3

Gene: Ssed_0501: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)

Gene: Ssed_0490: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
 
Shewanella sp ANA-3

Gene: Shewana3_0497: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
 
Shewanella sp MR-4

Gene: Shewmr4_0496: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
 
Shewanella sp MR-7

Gene: Shewmr7_3534: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
 
Shewanella sp W3-18-1

Gene: Sputw3181_0583: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
 2
Shewanella woodyi ATCC 51908

Gene: Swoo_4469: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)

Gene: Swoo_4448: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
tsrY
 
Shewanella amazonensis SB2B
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 2
Shewanella halifaxensis HAW-EB4

Gene: Shal_0560: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ

Gene: Shal_0576: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
 
Shewanella loihica PV-4

Gene: Shew_0357: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
 
Shewanella oneidensis MR-1

Gene: SO0488: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
 2
Shewanella pealeana ATCC 700345

Gene: Spea_0488: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ

Gene: Spea_0512: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
 
Shewanella piezotolerans WP3

Gene: swp_4647: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_3357: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
 2
Shewanella sediminis HAW-EB3

Gene: Ssed_0502: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ

Gene: Ssed_0491: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
 
Shewanella sp ANA-3

Gene: Shewana3_0498: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
 
Shewanella sp MR-4

Gene: Shewmr4_0497: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
 
Shewanella sp MR-7

Gene: Shewmr7_3533: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
 
Shewanella sp W3-18-1

Gene: Sputw3181_0584: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
 2
Shewanella woodyi ATCC 51908

Gene: Swoo_4468: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ

Gene: Swoo_4447: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
tsrR
 
Shewanella amazonensis SB2B
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 2
Shewanella halifaxensis HAW-EB4

Gene: Shal_0561: Predicted transcriptional regulator, winged HTH domain

Gene: Shal_0577: Predicted transcriptional regulator, winged HTH domain
 
Shewanella loihica PV-4

Gene: Shew_0358: Predicted transcriptional regulator, winged HTH domain
 
Shewanella oneidensis MR-1

Gene: SO0490: Predicted transcriptional regulator, winged HTH domain
 2
Shewanella pealeana ATCC 700345

Gene: Spea_0489: Predicted transcriptional regulator, winged HTH domain

Gene: Spea_0513: Predicted transcriptional regulator, winged HTH domain
 
Shewanella piezotolerans WP3

Gene: swp_4644: Predicted transcriptional regulator, winged HTH domain
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_3356: Predicted transcriptional regulator, winged HTH domain
 2
Shewanella sediminis HAW-EB3

Gene: Ssed_0503: Predicted transcriptional regulator, winged HTH domain

Gene: Ssed_0492: Predicted transcriptional regulator, winged HTH domain
 
Shewanella sp ANA-3

Gene: Shewana3_0499: Predicted transcriptional regulator, winged HTH domain
 
Shewanella sp MR-4

Gene: Shewmr4_0498: Predicted transcriptional regulator, winged HTH domain
 
Shewanella sp MR-7

Gene: Shewmr7_3532: Predicted transcriptional regulator, winged HTH domain
 
Shewanella sp W3-18-1

Gene: Sputw3181_0585: Predicted transcriptional regulator, winged HTH domain
 2
Shewanella woodyi ATCC 51908

Gene: Swoo_4467: Predicted transcriptional regulator, winged HTH domain

Gene: Swoo_4446: Predicted transcriptional regulator, winged HTH domain
Predicted transcriptional regulator, winged HTH domain
 
CRON 2.
ccmF-2
 
Shewanella amazonensis SB2B
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
*
Shewanella halifaxensis HAW-EB4

Site:
position = -314
score = 5.52002
sequence = ACCTTTTGACATCTAAAAGGAT

Gene: Shal_0550: Cytochrome c heme lyase subunit CcmF
*
Shewanella loihica PV-4

Site:
position = -169
score = 6.20201
sequence = GCATTTTTAGATCTCAAAAAAG

Site:
position = -139
score = 5.37216
sequence = GCTTTTTGAGTTATGAAAAATA

Gene: Shew_0347: Cytochrome c heme lyase subunit CcmF
*
Shewanella oneidensis MR-1

Site:
position = -281
score = 6.87076
sequence = GTTTTTTTAGATCTAAAAAAAC

Gene: SO0478: Cytochrome c heme lyase subunit CcmF
*
Shewanella pealeana ATCC 700345

Site:
position = -316
score = 4.79101
sequence = GCATTTTTTGATATCTAAAAAG

Site:
position = -314
score = 6.31096
sequence = ATTTTTTGATATCTAAAAAGAC

Gene: Spea_0478: Cytochrome c heme lyase subunit CcmF
*
Shewanella piezotolerans WP3

Site:
position = -258
score = 6.4489
sequence = TTATTTTTAGATCTAAAAAAAG

Gene: swp_4658: Cytochrome c heme lyase subunit CcmF
*
Shewanella putrefaciens CN-32

Site:
position = -334
score = 5.98059
sequence = TGTTTTTTAGAAGTAAAAAAGC

Site:
position = -313
score = 5.77197
sequence = CCTGTTTTAGTTATAAAAAAAA

Gene: Sputcn32_3365: Cytochrome c heme lyase subunit CcmF
*
Shewanella sediminis HAW-EB3

Site:
position = -314
score = 6.12805
sequence = TGTTTTTTAGATCTAAAAGGAT

Gene: Ssed_0481: Cytochrome c heme lyase subunit CcmF
*
Shewanella sp ANA-3

Site:
position = -284
score = 6.44135
sequence = GGCTTTTTAGATCTAAAAAGAG

Gene: Shewana3_0488: Cytochrome c heme lyase subunit CcmF
*
Shewanella sp MR-4

Site:
position = -315
score = 6.4162
sequence = GTTTTTTGAGATATAAAAAGAC

Gene: Shewmr4_0487: Cytochrome c heme lyase subunit CcmF
*
Shewanella sp MR-7

Site:
position = -316
score = 6.44938
sequence = GGTTTTTGAGATCTAAAAAGAC

Gene: Shewmr7_3543: Cytochrome c heme lyase subunit CcmF
*
Shewanella sp W3-18-1

Site:
position = -334
score = 5.98059
sequence = TGTTTTTTAGAAGTAAAAAAGC

Site:
position = -313
score = 5.77197
sequence = CCTGTTTTAGTTATAAAAAAAA

Gene: Sputw3181_0576: Cytochrome c heme lyase subunit CcmF
*
Shewanella woodyi ATCC 51908

Site:
position = -320
score = 5.73365
sequence = GTTTTTTGATATCTAAAAGGTT

Gene: Swoo_4478: Cytochrome c heme lyase subunit CcmF
Cytochrome c heme lyase subunit CcmF
ccmL
 
Shewanella amazonensis SB2B
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_0549: Cytochrome c heme lyase subunit CcmL
 
Shewanella loihica PV-4

Gene: Shew_0346: Cytochrome c heme lyase subunit CcmL
 
Shewanella oneidensis MR-1

Gene: SO0477: Cytochrome c heme lyase subunit CcmL
 
Shewanella pealeana ATCC 700345

Gene: Spea_0477: Cytochrome c heme lyase subunit CcmL
 
Shewanella piezotolerans WP3

Gene: swp_4659: Cytochrome c heme lyase subunit CcmL
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_3366: Cytochrome c heme lyase subunit CcmL
 
Shewanella sediminis HAW-EB3

Gene: Ssed_0480: Cytochrome c heme lyase subunit CcmL
 
Shewanella sp ANA-3

Gene: Shewana3_0487: Cytochrome c heme lyase subunit CcmL
 
Shewanella sp MR-4

Gene: Shewmr4_0486: Cytochrome c heme lyase subunit CcmL
 
Shewanella sp MR-7

Gene: Shewmr7_3544: Cytochrome c heme lyase subunit CcmL
 
Shewanella sp W3-18-1

Gene: Sputw3181_0575: Cytochrome c heme lyase subunit CcmL
 
Shewanella woodyi ATCC 51908

Gene: Swoo_4479: Cytochrome c heme lyase subunit CcmL
Cytochrome c heme lyase subunit CcmL
ccmH
 
Shewanella amazonensis SB2B
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_0548: Thioredoxin
 
Shewanella loihica PV-4

Gene: Shew_0345: Thioredoxin
 
Shewanella oneidensis MR-1

Gene: SO0476: Thioredoxin
 
Shewanella pealeana ATCC 700345

Gene: Spea_0476: Thioredoxin
 
Shewanella piezotolerans WP3

Gene: swp_4660: Thioredoxin
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_3367: Thioredoxin
 
Shewanella sediminis HAW-EB3

Gene: Ssed_0479: Thioredoxin
 
Shewanella sp ANA-3

Gene: Shewana3_0486: Thioredoxin
 
Shewanella sp MR-4

Gene: Shewmr4_0485: Thioredoxin
 
Shewanella sp MR-7

Gene: Shewmr7_3545: Thioredoxin
 
Shewanella sp W3-18-1

Gene: Sputw3181_0574: Thioredoxin
 
Shewanella woodyi ATCC 51908

Gene: Swoo_4480: Thioredoxin
Thioredoxin
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD