Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog MlnR - Ralstonia

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Malonate metabolism
Effector:
Phylum: Proteobacteria/Beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Cupriavidus taiwanensis 5 1
Ralstonia eutropha H16 5 1
Ralstonia eutropha JMP134 5 1
Ralstonia metallidurans CH34 5 1
Ralstonia pickettii 12J
Ralstonia solanacearum GMI1000
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
mlnR
*
Cupriavidus taiwanensis

Site:
position = -71
score = 6.70563
sequence = TAATTCATAATTATGAATTA

Gene: RALTA_A2456: Transcriptional regulator of malonate metabolism, GntR family
*
Ralstonia eutropha H16

Site:
position = -102
score = 6.5846
sequence = TAATCCATAATTATGAATTA

Gene: H16_A2982: Transcriptional regulator of malonate metabolism, GntR family
*
Ralstonia eutropha JMP134

Site:
position = -77
score = 6.50109
sequence = TCATCCATAATTATGAATTA

Gene: Reut_A0644: Transcriptional regulator of malonate metabolism, GntR family
*
Ralstonia metallidurans CH34

Site:
position = -63
score = 6.65499
sequence = TTATTCATAATTATGAATTA

Gene: Rmet_2798: Transcriptional regulator of malonate metabolism, GntR family
 
Ralstonia pickettii 12J
 
Ralstonia solanacearum GMI1000
Transcriptional regulator of malonate metabolism, GntR family
matA
 
Cupriavidus taiwanensis

Gene: RALTA_A2455: Malonyl-CoA decarboxylase
 
Ralstonia eutropha H16

Gene: H16_A2981: Malonyl-CoA decarboxylase
 
Ralstonia eutropha JMP134

Gene: Reut_A0645: Malonyl-CoA decarboxylase
 
Ralstonia metallidurans CH34

Gene: Rmet_2797: Malonyl-CoA decarboxylase
 
Ralstonia pickettii 12J
 
Ralstonia solanacearum GMI1000
Malonyl-CoA decarboxylase
h16_A2980
 
Cupriavidus taiwanensis

Gene: RALTA_A2454: putative exported protein
 
Ralstonia eutropha H16

Gene: H16_A2980: putative exported protein
 
Ralstonia eutropha JMP134

Gene: Reut_A0646: putative exported protein
 
Ralstonia metallidurans CH34

Gene: Rmet_2796: putative exported protein
 
Ralstonia pickettii 12J
 
Ralstonia solanacearum GMI1000
putative exported protein
h16_A2979
 
Cupriavidus taiwanensis

Gene: RALTA_A2453: methylmalonyl CoA decarboxylase/enoyl-CoA hydratase/isomerase
 
Ralstonia eutropha H16

Gene: H16_A2979: methylmalonyl CoA decarboxylase/enoyl-CoA hydratase/isomerase
 
Ralstonia eutropha JMP134

Gene: Reut_A0647: methylmalonyl CoA decarboxylase/enoyl-CoA hydratase/isomerase
 
Ralstonia metallidurans CH34

Gene: Rmet_2795: methylmalonyl CoA decarboxylase/enoyl-CoA hydratase/isomerase
 
Ralstonia pickettii 12J
 
Ralstonia solanacearum GMI1000
methylmalonyl CoA decarboxylase/enoyl-CoA hydratase/isomerase
matB
 
Cupriavidus taiwanensis

Gene: RALTA_A2452: Malonyl-CoA ligase (EC 6.2.1.3)
 
Ralstonia eutropha H16

Gene: H16_A2978: Malonyl-CoA ligase (EC 6.2.1.3)
 
Ralstonia eutropha JMP134

Gene: Reut_A0648: Malonyl-CoA ligase (EC 6.2.1.3)
 
Ralstonia metallidurans CH34

Gene: Rmet_2794: Malonyl-CoA ligase (EC 6.2.1.3)
 
Ralstonia pickettii 12J
 
Ralstonia solanacearum GMI1000
Malonyl-CoA ligase (EC 6.2.1.3)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD