Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CblR - Halobacteriales

Properties
Regulator type: Transcription factor
Regulator family:
Regulation mode:
Biological process: Cobalamin biosynthesis
Effector:
Phylum: Euryarchaeota
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 91 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Haloarcula marismortui ATCC 43049 12 7
Halobacterium salinarum R1 32 7
Halobacterium sp. NRC-1 32 7
Haloferax volcanii DS2 13 3
Halomicrobium mukohataei DSM 12286 31 10
Haloquadratum walsbyi DSM 16790 23 8
Halorhabdus utahensis DSM 12940 13 3
Halorubrum lacusprofundi ATCC 49239 24 9
Haloterrigena turkmenica DSM 5511 13 7
Natrialba magadii ATCC 43099 8 5
Natronomonas pharaonis DSM 2160 27 9
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
cbiT
*
Haloarcula marismortui ATCC 43049

Site:
position = -46
score = 5.7005
sequence = AATACAACCAAAATTGTTTT

Gene: rrnAC2998: Cobalt-precorrin-6y C15-methyltransferase [decarboxylating] (EC 2.1.1.-)
*
Halobacterium salinarum R1

Site:
position = -45
score = 5.63854
sequence = AATACAATCAAAATTGTTTT

Gene: OE3207F: Cobalt-precorrin-6y C15-methyltransferase [decarboxylating] (EC 2.1.1.-)
*
Halobacterium sp. NRC-1

Site:
position = -45
score = 5.63854
sequence = AATACAATCAAAATTGTTTT

Gene: VNG1550G: Cobalt-precorrin-6y C15-methyltransferase [decarboxylating] (EC 2.1.1.-)
*
Haloferax volcanii DS2

Site:
position = -123
score = 5.10688
sequence = AGAACAAGCGAGATTGTGTT

Site:
position = -150
score = 5.04933
sequence = AAACCAAGCACAGTTGTAAA

Site:
position = -47
score = 5.43003
sequence = ACAACAAGCACAATTGTTTT

Gene: HVO_B0062: Cobalt-precorrin-6y C15-methyltransferase [decarboxylating] (EC 2.1.1.-)
*
Halomicrobium mukohataei DSM 12286

Site:
position = -46
score = 5.69222
sequence = AAAACAACCAAAATTGTTTT

Gene: Hmuk_1874: Cobalt-precorrin-6y C15-methyltransferase [decarboxylating] (EC 2.1.1.-)
*
Haloquadratum walsbyi DSM 16790

Site:
position = -47
score = 5.3072
sequence = AGAGCAAGCGTAATTGTTTT

Site:
position = -113
score = 5.53781
sequence = AAAACAATTTTGCTTGTACT

Gene: HQ1834A: Cobalt-precorrin-6y C15-methyltransferase [decarboxylating] (EC 2.1.1.-)
 
Halorhabdus utahensis DSM 12940
*
Halorubrum lacusprofundi ATCC 49239

Site:
position = -46
score = 5.04216
sequence = AGCTCAACCAAAATTGTTTT

Gene: Hlac_3478: Cobalt-precorrin-6y C15-methyltransferase [decarboxylating] (EC 2.1.1.-)
*
Haloterrigena turkmenica DSM 5511

Site:
position = -46
score = 4.94547
sequence = ATACCAAACAAAATTGTTTT

Site:
position = -66
score = 4.38438
sequence = TGAGCAAGCGAACTTGCCTT

Gene: Htur_0996: Cobalt-precorrin-6y C15-methyltransferase [decarboxylating] (EC 2.1.1.-)
 
Natrialba magadii ATCC 43099
*
Natronomonas pharaonis DSM 2160

Site:
position = -46
score = 5.29007
sequence = AGCACAACCAAAATTGTTTT

Gene: NP1124A: Cobalt-precorrin-6y C15-methyltransferase [decarboxylating] (EC 2.1.1.-)
Cobalt-precorrin-6y C15-methyltransferase [decarboxylating] (EC 2.1.1.-)
cbiL
 
Haloarcula marismortui ATCC 43049

Gene: rrnAC3000: Cobalt-precorrin-2 C20-methyltransferase (EC 2.1.1.130)
 
Halobacterium salinarum R1

Gene: OE3209F: Cobalt-precorrin-2 C20-methyltransferase (EC 2.1.1.130)
 
Halobacterium sp. NRC-1

Gene: VNG1551G: Cobalt-precorrin-2 C20-methyltransferase (EC 2.1.1.130)
 
Haloferax volcanii DS2

Gene: HVO_B0061: Cobalt-precorrin-2 C20-methyltransferase (EC 2.1.1.130)
 
Halomicrobium mukohataei DSM 12286

Gene: Hmuk_1873: Cobalt-precorrin-2 C20-methyltransferase (EC 2.1.1.130)
 
Haloquadratum walsbyi DSM 16790

Gene: HQ1833A: Cobalt-precorrin-2 C20-methyltransferase (EC 2.1.1.130)
 
Halorhabdus utahensis DSM 12940
 
Halorubrum lacusprofundi ATCC 49239

Gene: Hlac_3477: Cobalt-precorrin-2 C20-methyltransferase (EC 2.1.1.130)
 
Haloterrigena turkmenica DSM 5511

Gene: Htur_0995: Cobalt-precorrin-2 C20-methyltransferase (EC 2.1.1.130)
 
Natrialba magadii ATCC 43099
 
Natronomonas pharaonis DSM 2160

Gene: NP1122A: Cobalt-precorrin-2 C20-methyltransferase (EC 2.1.1.130)
Cobalt-precorrin-2 C20-methyltransferase (EC 2.1.1.130)
cbiF
 
Haloarcula marismortui ATCC 43049

Gene: rrnAC3001: Cobalt-precorrin-4 C11-methyltransferase (EC 2.1.1.133)
 
Halobacterium salinarum R1

Gene: OE3212F: Cobalt-precorrin-4 C11-methyltransferase (EC 2.1.1.133)
 
Halobacterium sp. NRC-1

Gene: VNG1553G: Cobalt-precorrin-4 C11-methyltransferase (EC 2.1.1.133)
 
Haloferax volcanii DS2

Gene: HVO_B0060: Cobalt-precorrin-4 C11-methyltransferase (EC 2.1.1.133)
 
Halomicrobium mukohataei DSM 12286

Gene: Hmuk_1872: Cobalt-precorrin-4 C11-methyltransferase (EC 2.1.1.133)
 
Haloquadratum walsbyi DSM 16790

Gene: HQ1832A: Cobalt-precorrin-4 C11-methyltransferase (EC 2.1.1.133)
 
Halorhabdus utahensis DSM 12940
 
Halorubrum lacusprofundi ATCC 49239

Gene: Hlac_3476: Cobalt-precorrin-4 C11-methyltransferase (EC 2.1.1.133)
 
Haloterrigena turkmenica DSM 5511

Gene: Htur_0994: Cobalt-precorrin-4 C11-methyltransferase (EC 2.1.1.133)
 
Natrialba magadii ATCC 43099
 
Natronomonas pharaonis DSM 2160

Gene: NP1120A: Cobalt-precorrin-4 C11-methyltransferase (EC 2.1.1.133)
Cobalt-precorrin-4 C11-methyltransferase (EC 2.1.1.133)
cbiG
 
Haloarcula marismortui ATCC 43049

Gene: rrnAC3003: Cobalamin biosynthesis protein CbiG
 
Halobacterium salinarum R1

Gene: OE3213F: Cobalamin biosynthesis protein CbiG
 
Halobacterium sp. NRC-1

Gene: VNG1554G: Cobalamin biosynthesis protein CbiG
 
Haloferax volcanii DS2

Gene: HVO_B0059: Cobalamin biosynthesis protein CbiG
 
Halomicrobium mukohataei DSM 12286

Gene: Hmuk_1871: Cobalamin biosynthesis protein CbiG
*2
Haloquadratum walsbyi DSM 16790

Gene: HQ1831A: Cobalamin biosynthesis protein CbiG

Site:
position = -107
score = 5.31393
sequence = AAGACAACCGTAATTGTTTT

Gene: HQ3035A: Cobalamin biosynthesis protein CbiG
 
Halorhabdus utahensis DSM 12940
 
Halorubrum lacusprofundi ATCC 49239

Gene: Hlac_3475: Cobalamin biosynthesis protein CbiG
 
Haloterrigena turkmenica DSM 5511

Gene: Htur_0993: Cobalamin biosynthesis protein CbiG
 
Natrialba magadii ATCC 43099
 
Natronomonas pharaonis DSM 2160

Gene: NP1118A: Cobalamin biosynthesis protein CbiG
Cobalamin biosynthesis protein CbiG
cbiH
*2
Haloarcula marismortui ATCC 43049

Site:
position = -20
score = 5.53781
sequence = AGTACAAGCACAATTGTTTT

Gene: rrnAC3005: Cobalt-precorrin-3b C17-methyltransferase

Gene: rrnAC3008: Cobalt-precorrin-3b C17-methyltransferase
 2
Halobacterium salinarum R1

Gene: OE3214F: Cobalt-precorrin-3b C17-methyltransferase

Gene: OE3216F: Cobalt-precorrin-3b C17-methyltransferase
 2
Halobacterium sp. NRC-1

Gene: VNG1555G: Cobalt-precorrin-3b C17-methyltransferase

Gene: VNG1557G: Cobalt-precorrin-3b C17-methyltransferase
 2
Haloferax volcanii DS2

Gene: HVO_B0057: Cobalt-precorrin-3b C17-methyltransferase

Gene: HVO_B0058: Cobalt-precorrin-3b C17-methyltransferase
 2
Halomicrobium mukohataei DSM 12286

Gene: Hmuk_1869: Cobalt-precorrin-3b C17-methyltransferase

Gene: Hmuk_1870: Cobalt-precorrin-3b C17-methyltransferase
 2
Haloquadratum walsbyi DSM 16790

Gene: HQ3034A: Cobalt-precorrin-3b C17-methyltransferase

Gene: HQ3033A: Cobalt-precorrin-3b C17-methyltransferase
 
Halorhabdus utahensis DSM 12940
 2
Halorubrum lacusprofundi ATCC 49239

Gene: Hlac_3473: Cobalt-precorrin-3b C17-methyltransferase

Gene: Hlac_3474: Cobalt-precorrin-3b C17-methyltransferase
 2
Haloterrigena turkmenica DSM 5511

Gene: Htur_0992: Cobalt-precorrin-3b C17-methyltransferase

Gene: Htur_0991: Cobalt-precorrin-3b C17-methyltransferase
 
Natrialba magadii ATCC 43099
*2
Natronomonas pharaonis DSM 2160

Gene: NP1114A: Cobalt-precorrin-3b C17-methyltransferase

Site:
position = -101
score = 5.23884
sequence = ACAACAAGCACAATTGTTAT

Gene: NP1116A: Cobalt-precorrin-3b C17-methyltransferase
Cobalt-precorrin-3b C17-methyltransferase
VNG1558H
 
Haloarcula marismortui ATCC 43049

Gene: rrnAC3009: conserved cobalamin operon protein
 
Halobacterium salinarum R1

Gene: OE3219F: conserved cobalamin operon protein
 
Halobacterium sp. NRC-1

Gene: VNG1558H: conserved cobalamin operon protein
 
Haloferax volcanii DS2

Gene: HVO_B0056: conserved cobalamin operon protein
 
Halomicrobium mukohataei DSM 12286

Gene: Hmuk_1868: conserved cobalamin operon protein
 
Haloquadratum walsbyi DSM 16790

Gene: HQ1830A: conserved cobalamin operon protein
 
Halorhabdus utahensis DSM 12940
 
Halorubrum lacusprofundi ATCC 49239

Gene: Hlac_3472: conserved cobalamin operon protein
 
Haloterrigena turkmenica DSM 5511

Gene: Htur_0990: conserved cobalamin operon protein
 
Natrialba magadii ATCC 43099
 
Natronomonas pharaonis DSM 2160

Gene: NP1112A: conserved cobalamin operon protein
conserved cobalamin operon protein
VNG1559H
 
Haloarcula marismortui ATCC 43049

Gene: rrnAC3010: conserved cobalamin operon protein
 
Halobacterium salinarum R1

Gene: OE3218F: conserved cobalamin operon protein
 
Halobacterium sp. NRC-1

Gene: VNG1559H: conserved cobalamin operon protein
 
Haloferax volcanii DS2

Gene: HVO_B0055: conserved cobalamin operon protein
 
Halomicrobium mukohataei DSM 12286

Gene: Hmuk_1867: conserved cobalamin operon protein
 
Haloquadratum walsbyi DSM 16790

Gene: HQ3032B: conserved cobalamin operon protein
 
Halorhabdus utahensis DSM 12940
 
Halorubrum lacusprofundi ATCC 49239

Gene: Hlac_3471: conserved cobalamin operon protein
 
Haloterrigena turkmenica DSM 5511

Gene: Htur_0989: conserved cobalamin operon protein
 
Natrialba magadii ATCC 43099
 
Natronomonas pharaonis DSM 2160

Gene: NP1110A: conserved cobalamin operon protein
conserved cobalamin operon protein
cbiK
 
Haloarcula marismortui ATCC 43049

Gene: rrnAC3011: Sirohydrochlorin cobaltochelatase (EC 4.99.1.3) / Putative 2Fe-2S ferredoxin CbiW involved in B12 biosynthesis
 
Halobacterium salinarum R1

Gene: OE3221F: Sirohydrochlorin cobaltochelatase (EC 4.99.1.3) / Putative 2Fe-2S ferredoxin CbiW involved in B12 biosynthesis
 
Halobacterium sp. NRC-1

Gene: VNG1561Cm: Sirohydrochlorin cobaltochelatase (EC 4.99.1.3) / Putative 2Fe-2S ferredoxin CbiW involved in B12 biosynthesis
 
Haloferax volcanii DS2

Gene: HVO_B0054: Sirohydrochlorin cobaltochelatase (EC 4.99.1.3) / Putative 2Fe-2S ferredoxin CbiW involved in B12 biosynthesis
 
Halomicrobium mukohataei DSM 12286

Gene: Hmuk_1866: Sirohydrochlorin cobaltochelatase (EC 4.99.1.3) / Putative 2Fe-2S ferredoxin CbiW involved in B12 biosynthesis
 
Haloquadratum walsbyi DSM 16790

Gene: HQ3032A: Sirohydrochlorin cobaltochelatase (EC 4.99.1.3) / Putative 2Fe-2S ferredoxin CbiW involved in B12 biosynthesis
 
Halorhabdus utahensis DSM 12940
 
Halorubrum lacusprofundi ATCC 49239

Gene: Hlac_3470: Sirohydrochlorin cobaltochelatase (EC 4.99.1.3) / Putative 2Fe-2S ferredoxin CbiW involved in B12 biosynthesis
 
Haloterrigena turkmenica DSM 5511

Gene: Htur_0988: Sirohydrochlorin cobaltochelatase (EC 4.99.1.3) / Putative 2Fe-2S ferredoxin CbiW involved in B12 biosynthesis
 
Natrialba magadii ATCC 43099
 
Natronomonas pharaonis DSM 2160

Gene: NP1108A: Sirohydrochlorin cobaltochelatase (EC 4.99.1.3) / Putative 2Fe-2S ferredoxin CbiW involved in B12 biosynthesis
Sirohydrochlorin cobaltochelatase (EC 4.99.1.3) / Putative 2Fe-2S ferredoxin CbiW involved in B12 biosynthesis
VNG1562H
 
Haloarcula marismortui ATCC 43049

Gene: rrnAC3012: conserved cobalamin operon protein
 
Halobacterium salinarum R1

Gene: OE3224F: conserved cobalamin operon protein
 
Halobacterium sp. NRC-1

Gene: VNG1562H: conserved cobalamin operon protein
 
Haloferax volcanii DS2

Gene: HVO_B0053: conserved cobalamin operon protein
 
Halomicrobium mukohataei DSM 12286

Gene: Hmuk_1865: conserved cobalamin operon protein
 
Haloquadratum walsbyi DSM 16790

Gene: HQ3031A: conserved cobalamin operon protein
 
Halorhabdus utahensis DSM 12940
 
Halorubrum lacusprofundi ATCC 49239

Gene: Hlac_3469: conserved cobalamin operon protein
 
Haloterrigena turkmenica DSM 5511

Gene: Htur_0987: conserved cobalamin operon protein
 
Natrialba magadii ATCC 43099
 
Natronomonas pharaonis DSM 2160

Gene: NP1106A: conserved cobalamin operon protein
conserved cobalamin operon protein
cobT
 
Haloarcula marismortui ATCC 43049

Gene: rrnAC1101: Nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase (EC 2.4.2.21)
*2
Halobacterium salinarum R1

Gene: OE3227F: Nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase (EC 2.4.2.21)

Site:
position = -120
score = 4.77874
sequence = AACCCAACTGTGGTTGCATA

Gene: OE3242F: Nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase (EC 2.4.2.21)
*2
Halobacterium sp. NRC-1

Gene: VNG1564H: Nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase (EC 2.4.2.21)

Site:
position = -219
score = 4.77874
sequence = AACCCAACTGTGGTTGCATA

Gene: VNG1572C: Nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase (EC 2.4.2.21)
 
Haloferax volcanii DS2

Gene: HVO_0590: Nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase (EC 2.4.2.21)
 
Halomicrobium mukohataei DSM 12286

Gene: Hmuk_2245: Nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase (EC 2.4.2.21)
 
Haloquadratum walsbyi DSM 16790

Gene: HQ1408A: Nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase (EC 2.4.2.21)
 
Halorhabdus utahensis DSM 12940

Gene: Huta_2498: Nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase (EC 2.4.2.21)
 
Halorubrum lacusprofundi ATCC 49239

Gene: Hlac_0230: Nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase (EC 2.4.2.21)
 
Haloterrigena turkmenica DSM 5511

Gene: Htur_2836: Nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase (EC 2.4.2.21)
 
Natrialba magadii ATCC 43099

Gene: Nmag_0990: Nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase (EC 2.4.2.21)
*
Natronomonas pharaonis DSM 2160

Site:
position = -33
score = 4.10747
sequence = GGTTCAAGTACACTTGTCCA

Site:
position = -97
score = 4.37519
sequence = ACAGCAATTCGGCTTGTACA

Site:
position = -117
score = 5.40741
sequence = TAATCAAGTATAGTTGTATT

Gene: NP0736A: Nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase (EC 2.4.2.21)
Nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase (EC 2.4.2.21)
cbiA
 
Haloarcula marismortui ATCC 43049

Gene: rrnAC1102: Cobyrinic acid A,C-diamide synthase
 
Halobacterium salinarum R1

Gene: OE3243F: Cobyrinic acid A,C-diamide synthase
 
Halobacterium sp. NRC-1

Gene: VNG1573G: Cobyrinic acid A,C-diamide synthase
 
Haloferax volcanii DS2

Gene: HVO_A0487: Cobyrinic acid A,C-diamide synthase
 
Halomicrobium mukohataei DSM 12286

Gene: Hmuk_1855: Cobyrinic acid A,C-diamide synthase
 
Haloquadratum walsbyi DSM 16790

Gene: HQ1829A: Cobyrinic acid A,C-diamide synthase
 
Halorhabdus utahensis DSM 12940
 
Halorubrum lacusprofundi ATCC 49239

Gene: Hlac_0231: Cobyrinic acid A,C-diamide synthase
 
Haloterrigena turkmenica DSM 5511

Gene: Htur_0999: Cobyrinic acid A,C-diamide synthase
*
Natrialba magadii ATCC 43099

Site:
position = -115
score = 4.42529
sequence = AGTTCAAGTACAGTTGTGTG

Gene: Nmag_3175: Cobyrinic acid A,C-diamide synthase
 
Natronomonas pharaonis DSM 2160

Gene: NP0738A: Cobyrinic acid A,C-diamide synthase
Cobyrinic acid A,C-diamide synthase
btuR
 
Haloarcula marismortui ATCC 43049

Gene: rrnAC1936: Cob(I)alamin adenosyltransferase (EC 2.5.1.17)
 
Halobacterium salinarum R1

Gene: OE3245F: Cob(I)alamin adenosyltransferase (EC 2.5.1.17)
 
Halobacterium sp. NRC-1

Gene: VNG1574G: Cob(I)alamin adenosyltransferase (EC 2.5.1.17)
 
Haloferax volcanii DS2

Gene: HVO_A0488: Cob(I)alamin adenosyltransferase (EC 2.5.1.17)
 
Halomicrobium mukohataei DSM 12286

Gene: Hmuk_0139: Cob(I)alamin adenosyltransferase (EC 2.5.1.17)
 
Haloquadratum walsbyi DSM 16790

Gene: HQ1405A: Cob(I)alamin adenosyltransferase (EC 2.5.1.17)
 
Halorhabdus utahensis DSM 12940

Gene: Huta_2501: Cob(I)alamin adenosyltransferase (EC 2.5.1.17)
 
Halorubrum lacusprofundi ATCC 49239

Gene: Hlac_0237: Cob(I)alamin adenosyltransferase (EC 2.5.1.17)
 
Haloterrigena turkmenica DSM 5511

Gene: Htur_5207: Cob(I)alamin adenosyltransferase (EC 2.5.1.17)
 
Natrialba magadii ATCC 43099

Gene: Nmag_3073: Cob(I)alamin adenosyltransferase (EC 2.5.1.17)
 
Natronomonas pharaonis DSM 2160

Gene: NP4974A: Cob(I)alamin adenosyltransferase (EC 2.5.1.17)
Cob(I)alamin adenosyltransferase (EC 2.5.1.17)
cbiP
 
Haloarcula marismortui ATCC 43049

Gene: rrnAC1938: Cobyric acid synthase
 
Halobacterium salinarum R1

Gene: OE3246F: Cobyric acid synthase
 
Halobacterium sp. NRC-1

Gene: VNG1576G: Cobyric acid synthase
 
Haloferax volcanii DS2

Gene: HVO_A0553: Cobyric acid synthase
 
Halomicrobium mukohataei DSM 12286

Gene: Hmuk_1854: Cobyric acid synthase
 
Haloquadratum walsbyi DSM 16790

Gene: HQ1404A: Cobyric acid synthase
 
Halorhabdus utahensis DSM 12940

Gene: Huta_2504: Cobyric acid synthase
 
Halorubrum lacusprofundi ATCC 49239

Gene: Hlac_0238: Cobyric acid synthase
 
Haloterrigena turkmenica DSM 5511

Gene: Htur_5212: Cobyric acid synthase
 
Natrialba magadii ATCC 43099

Gene: Nmag_3068: Cobyric acid synthase
 
Natronomonas pharaonis DSM 2160

Gene: NP5126A: Cobyric acid synthase
Cobyric acid synthase
VNG1577C
 
Haloarcula marismortui ATCC 43049
 
Halobacterium salinarum R1

Gene: OE3249F: conserved cobalamine operon protein, HAD family hydrolase
 
Halobacterium sp. NRC-1

Gene: VNG1577C: conserved cobalamine operon protein, HAD family hydrolase
 
Haloferax volcanii DS2

Gene: HVO_0586: conserved cobalamine operon protein, HAD family hydrolase
*
Halomicrobium mukohataei DSM 12286

Site:
position = -32
score = 4.59199
sequence = AGTTCAAGTGTGCTTGCGGT

Gene: Hmuk_0145: conserved cobalamine operon protein, HAD family hydrolase
 
Haloquadratum walsbyi DSM 16790

Gene: HQ1412A: conserved cobalamine operon protein, HAD family hydrolase
 
Halorhabdus utahensis DSM 12940
 
Halorubrum lacusprofundi ATCC 49239

Gene: Hlac_0642: conserved cobalamine operon protein, HAD family hydrolase
 
Haloterrigena turkmenica DSM 5511

Gene: Htur_2832: conserved cobalamine operon protein, HAD family hydrolase
 
Natrialba magadii ATCC 43099

Gene: Nmag_0986: conserved cobalamine operon protein, HAD family hydrolase
 
Natronomonas pharaonis DSM 2160

Gene: NP5310A: conserved cobalamine operon protein, HAD family hydrolase
conserved cobalamine operon protein, HAD family hydrolase
cbiB
 
Haloarcula marismortui ATCC 43049

Gene: rrnAC1930: Adenosylcobinamide-phosphate synthase
 
Halobacterium salinarum R1

Gene: OE3253F: Adenosylcobinamide-phosphate synthase
 
Halobacterium sp. NRC-1

Gene: VNG1578H: Adenosylcobinamide-phosphate synthase
 
Haloferax volcanii DS2

Gene: HVO_0587: Adenosylcobinamide-phosphate synthase
 
Halomicrobium mukohataei DSM 12286

Gene: Hmuk_0144: Adenosylcobinamide-phosphate synthase
 
Haloquadratum walsbyi DSM 16790

Gene: HQ1411A: Adenosylcobinamide-phosphate synthase
 
Halorhabdus utahensis DSM 12940

Gene: Huta_2495: Adenosylcobinamide-phosphate synthase
 
Halorubrum lacusprofundi ATCC 49239

Gene: Hlac_0232: Adenosylcobinamide-phosphate synthase
 
Haloterrigena turkmenica DSM 5511

Gene: Htur_2833: Adenosylcobinamide-phosphate synthase
 
Natrialba magadii ATCC 43099

Gene: Nmag_0987: Adenosylcobinamide-phosphate synthase
 
Natronomonas pharaonis DSM 2160

Gene: NP5308A: Adenosylcobinamide-phosphate synthase
Adenosylcobinamide-phosphate synthase
cobS
 
Haloarcula marismortui ATCC 43049

Gene: rrnAC1931: Cobalamin synthase
 
Halobacterium salinarum R1

Gene: OE3255F: Cobalamin synthase
 
Halobacterium sp. NRC-1

Gene: VNG1580H: Cobalamin synthase
 
Haloferax volcanii DS2

Gene: HVO_0588: Cobalamin synthase
 
Halomicrobium mukohataei DSM 12286

Gene: Hmuk_0143: Cobalamin synthase
 
Haloquadratum walsbyi DSM 16790

Gene: HQ1410A: Cobalamin synthase
 
Halorhabdus utahensis DSM 12940

Gene: Huta_2496: Cobalamin synthase
 
Halorubrum lacusprofundi ATCC 49239

Gene: Hlac_0233: Cobalamin synthase
 
Haloterrigena turkmenica DSM 5511

Gene: Htur_2834: Cobalamin synthase
 
Natrialba magadii ATCC 43099

Gene: Nmag_0988: Cobalamin synthase
 
Natronomonas pharaonis DSM 2160

Gene: NP5306A: Cobalamin synthase
Cobalamin synthase
cobY
 
Haloarcula marismortui ATCC 43049

Gene: rrnAC1932: Predicted adenosylcobinamide-phosphate guanylyltransferase CobY (EC 2.7.7.62)
 
Halobacterium salinarum R1

Gene: OE3257F: Predicted adenosylcobinamide-phosphate guanylyltransferase CobY (EC 2.7.7.62)
 
Halobacterium sp. NRC-1

Gene: VNG1581C: Predicted adenosylcobinamide-phosphate guanylyltransferase CobY (EC 2.7.7.62)
 
Haloferax volcanii DS2

Gene: HVO_0589: Predicted adenosylcobinamide-phosphate guanylyltransferase CobY (EC 2.7.7.62)
 
Halomicrobium mukohataei DSM 12286

Gene: Hmuk_0142: Predicted adenosylcobinamide-phosphate guanylyltransferase CobY (EC 2.7.7.62)
 
Haloquadratum walsbyi DSM 16790

Gene: HQ1409A: Predicted adenosylcobinamide-phosphate guanylyltransferase CobY (EC 2.7.7.62)
 
Halorhabdus utahensis DSM 12940

Gene: Huta_2497: Predicted adenosylcobinamide-phosphate guanylyltransferase CobY (EC 2.7.7.62)
 
Halorubrum lacusprofundi ATCC 49239

Gene: Hlac_0234: Predicted adenosylcobinamide-phosphate guanylyltransferase CobY (EC 2.7.7.62)
 
Haloterrigena turkmenica DSM 5511

Gene: Htur_2835: Predicted adenosylcobinamide-phosphate guanylyltransferase CobY (EC 2.7.7.62)
 
Natrialba magadii ATCC 43099

Gene: Nmag_0989: Predicted adenosylcobinamide-phosphate guanylyltransferase CobY (EC 2.7.7.62)
 
Natronomonas pharaonis DSM 2160

Gene: NP5304A: Predicted adenosylcobinamide-phosphate guanylyltransferase CobY (EC 2.7.7.62)
Predicted adenosylcobinamide-phosphate guanylyltransferase CobY (EC 2.7.7.62)
cobD
 
Haloarcula marismortui ATCC 43049

Gene: rrnAC1934: L-threonine 3-O-phosphate decarboxylase (EC 4.1.1.81)
 
Halobacterium salinarum R1

Gene: OE3259F: L-threonine 3-O-phosphate decarboxylase (EC 4.1.1.81)
 
Halobacterium sp. NRC-1

Gene: VNG1582G: L-threonine 3-O-phosphate decarboxylase (EC 4.1.1.81)
 2
Haloferax volcanii DS2

Gene: HVO_0593: L-threonine 3-O-phosphate decarboxylase (EC 4.1.1.81)

Gene: HVO_0591: L-threonine 3-O-phosphate decarboxylase (EC 4.1.1.81)
 
Halomicrobium mukohataei DSM 12286

Gene: Hmuk_0141: L-threonine 3-O-phosphate decarboxylase (EC 4.1.1.81)
 
Haloquadratum walsbyi DSM 16790

Gene: HQ1407A: L-threonine 3-O-phosphate decarboxylase (EC 4.1.1.81)
 
Halorhabdus utahensis DSM 12940

Gene: Huta_2499: L-threonine 3-O-phosphate decarboxylase (EC 4.1.1.81)
 
Halorubrum lacusprofundi ATCC 49239

Gene: Hlac_0235: L-threonine 3-O-phosphate decarboxylase (EC 4.1.1.81)
 
Haloterrigena turkmenica DSM 5511

Gene: Htur_2837: L-threonine 3-O-phosphate decarboxylase (EC 4.1.1.81)
 
Natrialba magadii ATCC 43099

Gene: Nmag_0991: L-threonine 3-O-phosphate decarboxylase (EC 4.1.1.81)
 
Natronomonas pharaonis DSM 2160

Gene: NP5302A: L-threonine 3-O-phosphate decarboxylase (EC 4.1.1.81)
L-threonine 3-O-phosphate decarboxylase (EC 4.1.1.81)
cbiZ
 
Haloarcula marismortui ATCC 43049

Gene: rrnAC1935: Adenosylcobinamide amidohydrolase (EC 3.5.1.90)
 
Halobacterium salinarum R1

Gene: OE3261F: Adenosylcobinamide amidohydrolase (EC 3.5.1.90)
 
Halobacterium sp. NRC-1

Gene: VNG1583C: Adenosylcobinamide amidohydrolase (EC 3.5.1.90)
 
Haloferax volcanii DS2

Gene: HVO_0592: Adenosylcobinamide amidohydrolase (EC 3.5.1.90)
 
Halomicrobium mukohataei DSM 12286

Gene: Hmuk_0140: Adenosylcobinamide amidohydrolase (EC 3.5.1.90)
 
Haloquadratum walsbyi DSM 16790

Gene: HQ1406A: Adenosylcobinamide amidohydrolase (EC 3.5.1.90)
 
Halorhabdus utahensis DSM 12940

Gene: Huta_2500: Adenosylcobinamide amidohydrolase (EC 3.5.1.90)
 
Halorubrum lacusprofundi ATCC 49239

Gene: Hlac_0236: Adenosylcobinamide amidohydrolase (EC 3.5.1.90)
 
Haloterrigena turkmenica DSM 5511

Gene: Htur_2838: Adenosylcobinamide amidohydrolase (EC 3.5.1.90)
 
Natrialba magadii ATCC 43099

Gene: Nmag_0992: Adenosylcobinamide amidohydrolase (EC 3.5.1.90)
 
Natronomonas pharaonis DSM 2160

Gene: NP5300A: Adenosylcobinamide amidohydrolase (EC 3.5.1.90)
Adenosylcobinamide amidohydrolase (EC 3.5.1.90)
btuF
 
Haloarcula marismortui ATCC 43049

Gene: rrnAC3375: Vitamin B12 ABC transporter, B12-binding component BtuF
 
Halobacterium salinarum R1

Gene: OE2951R: Vitamin B12 ABC transporter, B12-binding component BtuF
 
Halobacterium sp. NRC-1

Gene: VNG1369G: Vitamin B12 ABC transporter, B12-binding component BtuF
 
Haloferax volcanii DS2

Gene: HVO_1110: Vitamin B12 ABC transporter, B12-binding component BtuF
*
Halomicrobium mukohataei DSM 12286

Site:
position = -60
score = 4.06726
sequence = GTTCCAACCACAGTTGGGAT

Gene: Hmuk_2791: Vitamin B12 ABC transporter, B12-binding component BtuF
*
Haloquadratum walsbyi DSM 16790

Site:
position = -64
score = 4.64993
sequence = TATACAAACGCACTTGCAGT

Gene: HQ1628A: Vitamin B12 ABC transporter, B12-binding component BtuF
*
Halorhabdus utahensis DSM 12940

Site:
position = -59
score = 4.60461
sequence = ACGACAAGTTGAGTTGCATT

Gene: Huta_2494: Vitamin B12 ABC transporter, B12-binding component BtuF
*
Halorubrum lacusprofundi ATCC 49239

Site:
position = -58
score = 4.28481
sequence = TCTCCAACAAAACTTGTAGT

Gene: Hlac_0880: Vitamin B12 ABC transporter, B12-binding component BtuF
*
Haloterrigena turkmenica DSM 5511

Site:
position = -58
score = 4.70745
sequence = GATCCAACCACGGTTGGTTT

Gene: Htur_1830: Vitamin B12 ABC transporter, B12-binding component BtuF
*2
Natrialba magadii ATCC 43099

Site:
position = -58
score = 4.89006
sequence = AATGCAACTCTGATTGCAAT

Gene: Nmag_1837: Vitamin B12 ABC transporter, B12-binding component BtuF

Site:
position = -58
score = 4.9868
sequence = TGTGCAAGCATGATTGCTTT

Gene: Nmag_3605: Vitamin B12 ABC transporter, B12-binding component BtuF
*
Natronomonas pharaonis DSM 2160

Site:
position = -57
score = 4.1954
sequence = GCTGCAACTGGGCTTGGTTT

Gene: NP3814A: Vitamin B12 ABC transporter, B12-binding component BtuF
Vitamin B12 ABC transporter, B12-binding component BtuF
 
CRON 2.
chlID
*
Haloarcula marismortui ATCC 43049

Site:
position = -9
score = 5.86458
sequence = AATACAAGTATGGTTGTATT

Gene: rrnAC3018: ChlI component of cobalt chelatase involved in B12 biosynthesis / ChlD component of cobalt chelatase involved in B12 biosynthesis
*
Halobacterium salinarum R1

Site:
position = -9
score = 5.45308
sequence = ATTACAACTATGGTTGATTT

Gene: OE3229R: ChlI component of cobalt chelatase involved in B12 biosynthesis / ChlD component of cobalt chelatase involved in B12 biosynthesis
*
Halobacterium sp. NRC-1

Site:
position = -9
score = 5.45308
sequence = ATTACAACTATGGTTGATTT

Gene: VNG1565G: ChlI component of cobalt chelatase involved in B12 biosynthesis / ChlD component of cobalt chelatase involved in B12 biosynthesis
 
Haloferax volcanii DS2

Gene: HVO_B0051: ChlI component of cobalt chelatase involved in B12 biosynthesis / ChlD component of cobalt chelatase involved in B12 biosynthesis
*
Halomicrobium mukohataei DSM 12286

Site:
position = -9
score = 5.52886
sequence = AATACAAGCATGATTGATTT

Gene: Hmuk_1860: ChlI component of cobalt chelatase involved in B12 biosynthesis / ChlD component of cobalt chelatase involved in B12 biosynthesis
*
Haloquadratum walsbyi DSM 16790

Site:
position = -18
score = 4.15721
sequence = AGTGCAAAAAAGGTTGATAT

Gene: HQ2295A: ChlI component of cobalt chelatase involved in B12 biosynthesis / ChlD component of cobalt chelatase involved in B12 biosynthesis
 
Halorhabdus utahensis DSM 12940
*
Halorubrum lacusprofundi ATCC 49239

Site:
position = -9
score = 5.40043
sequence = ACTACAACCATGGTTGATTT

Gene: Hlac_3462: ChlI component of cobalt chelatase involved in B12 biosynthesis / ChlD component of cobalt chelatase involved in B12 biosynthesis
*
Haloterrigena turkmenica DSM 5511

Site:
position = -9
score = 4.60058
sequence = AGCGCAACTATGGTTGCAGA

Gene: Htur_1006: ChlI component of cobalt chelatase involved in B12 biosynthesis / ChlD component of cobalt chelatase involved in B12 biosynthesis
 
Natrialba magadii ATCC 43099
*
Natronomonas pharaonis DSM 2160

Site:
position = -29
score = 4.01304
sequence = TGATAAACTCCGGTTGTTCT

Site:
position = -9
score = 4.64701
sequence = AATACAACCGTGATTGACAA

Gene: NP1094A: ChlI component of cobalt chelatase involved in B12 biosynthesis / ChlD component of cobalt chelatase involved in B12 biosynthesis
ChlI component of cobalt chelatase involved in B12 biosynthesis / ChlD component of cobalt chelatase involved in B12 biosynthesis
cbtB
*
Haloarcula marismortui ATCC 43049

Site:
position = -39
score = 5.12809
sequence = TTTACAATCTTACTTGTTCT

Gene: rrnAC3016: Cobalt transporter subunit CbtB, putative
 
Halobacterium salinarum R1
 
Halobacterium sp. NRC-1
*
Haloferax volcanii DS2

Site:
position = -142
score = 5.43003
sequence = AAAACAATTGTGCTTGTTGT

Site:
position = -66
score = 5.10688
sequence = AACACAATCTCGCTTGTTCT

Site:
position = -39
score = 5.04933
sequence = TTTACAACTGTGCTTGGTTT

Gene: HVO_B0063: Cobalt transporter subunit CbtB, putative
*
Halomicrobium mukohataei DSM 12286

Site:
position = -38
score = 4.73694
sequence = TTTACAATCTAGTTTGTACT

Gene: Hmuk_1861: Cobalt transporter subunit CbtB, putative
 
Haloquadratum walsbyi DSM 16790
 
Halorhabdus utahensis DSM 12940
*
Halorubrum lacusprofundi ATCC 49239

Site:
position = -39
score = 4.91175
sequence = TTTACAAGCTCAGTTGTGTT

Gene: Hlac_3463: Cobalt transporter subunit CbtB, putative
*
Haloterrigena turkmenica DSM 5511

Site:
position = -37
score = 5.33734
sequence = TTTACAACTATACTTGTTCT

Gene: Htur_5160: Cobalt transporter subunit CbtB, putative
 
Natrialba magadii ATCC 43099
 
Natronomonas pharaonis DSM 2160

Gene: NP1096A: Cobalt transporter subunit CbtB, putative
Cobalt transporter subunit CbtB, putative
cbtA
*
Haloarcula marismortui ATCC 43049

Site:
position = -245
score = 5.12809
sequence = TTTACAATCTTACTTGTTCT

Gene: rrnAC3015: Predicted cobalt transporter CbtA
 
Halobacterium salinarum R1
 
Halobacterium sp. NRC-1
*
Haloferax volcanii DS2

Site:
position = -227
score = 5.04933
sequence = TTTACAACTGTGCTTGGTTT

Gene: HVO_B0064: Predicted cobalt transporter CbtA
*
Halomicrobium mukohataei DSM 12286

Site:
position = -229
score = 4.73694
sequence = TTTACAATCTAGTTTGTACT

Gene: Hmuk_1862: Predicted cobalt transporter CbtA
 
Haloquadratum walsbyi DSM 16790
 
Halorhabdus utahensis DSM 12940
*
Halorubrum lacusprofundi ATCC 49239

Site:
position = -229
score = 4.91175
sequence = TTTACAAGCTCAGTTGTGTT

Gene: Hlac_3464: Predicted cobalt transporter CbtA
*
Haloterrigena turkmenica DSM 5511

Site:
position = -229
score = 5.33734
sequence = TTTACAACTATACTTGTTCT

Gene: Htur_5161: Predicted cobalt transporter CbtA
 
Natrialba magadii ATCC 43099
 
Natronomonas pharaonis DSM 2160

Gene: NP1098A: Predicted cobalt transporter CbtA
Predicted cobalt transporter CbtA
cbiX_2
 
Haloarcula marismortui ATCC 43049
 
Halobacterium salinarum R1
 
Halobacterium sp. NRC-1
 
Haloferax volcanii DS2

Gene: HVO_B0065: conserved cobalamin cluster protein CbiX 2 (probable ferredoxin-like iron-sulfur protein)
 
Halomicrobium mukohataei DSM 12286

Gene: Hmuk_1863: conserved cobalamin cluster protein CbiX 2 (probable ferredoxin-like iron-sulfur protein)
 
Haloquadratum walsbyi DSM 16790
 
Halorhabdus utahensis DSM 12940
 
Halorubrum lacusprofundi ATCC 49239

Gene: Hlac_3465: conserved cobalamin cluster protein CbiX 2 (probable ferredoxin-like iron-sulfur protein)
 
Haloterrigena turkmenica DSM 5511

Gene: Htur_5162: conserved cobalamin cluster protein CbiX 2 (probable ferredoxin-like iron-sulfur protein)
 
Natrialba magadii ATCC 43099
 
Natronomonas pharaonis DSM 2160

Gene: NP1100A: conserved cobalamin cluster protein CbiX 2 (probable ferredoxin-like iron-sulfur protein)
conserved cobalamin cluster protein CbiX 2 (probable ferredoxin-like iron-sulfur protein)
 
CRON 3.
cobN
*
Haloarcula marismortui ATCC 43049

Site:
position = -46
score = 5.86458
sequence = AATACAACCATACTTGTATT

Gene: rrnAC3019: CobN component of cobalt chelatase involved in B12 biosynthesis
*
Halobacterium salinarum R1

Site:
position = -45
score = 5.45308
sequence = AAATCAACCATAGTTGTAAT

Gene: OE3230F: CobN component of cobalt chelatase involved in B12 biosynthesis
*
Halobacterium sp. NRC-1

Site:
position = -240
score = 5.45308
sequence = AAATCAACCATAGTTGTAAT

Gene: VNG1566G: CobN component of cobalt chelatase involved in B12 biosynthesis
 
Haloferax volcanii DS2

Gene: HVO_B0050: CobN component of cobalt chelatase involved in B12 biosynthesis
*
Halomicrobium mukohataei DSM 12286

Site:
position = -45
score = 5.52886
sequence = AAATCAATCATGCTTGTATT

Gene: Hmuk_1859: CobN component of cobalt chelatase involved in B12 biosynthesis
*
Haloquadratum walsbyi DSM 16790

Site:
position = -45
score = 4.15721
sequence = ATATCAACCTTTTTTGCACT

Gene: HQ2296A: CobN component of cobalt chelatase involved in B12 biosynthesis
 
Halorhabdus utahensis DSM 12940
*
Halorubrum lacusprofundi ATCC 49239

Site:
position = -45
score = 5.40043
sequence = AAATCAACCATGGTTGTAGT

Gene: Hlac_3461: CobN component of cobalt chelatase involved in B12 biosynthesis
*
Haloterrigena turkmenica DSM 5511

Site:
position = -45
score = 4.60058
sequence = TCTGCAACCATAGTTGCGCT

Gene: Htur_1005: CobN component of cobalt chelatase involved in B12 biosynthesis
 
Natrialba magadii ATCC 43099
*
Natronomonas pharaonis DSM 2160

Site:
position = -45
score = 4.64701
sequence = TTGTCAATCACGGTTGTATT

Site:
position = -25
score = 4.01304
sequence = AGAACAACCGGAGTTTATCA

Gene: NP1092A: CobN component of cobalt chelatase involved in B12 biosynthesis
CobN component of cobalt chelatase involved in B12 biosynthesis
cbiC
 
Haloarcula marismortui ATCC 43049

Gene: rrnAC3020: Cobalt-precorrin-8x methylmutase (EC 5.4.1.2)
 
Halobacterium salinarum R1

Gene: OE3237F: Cobalt-precorrin-8x methylmutase (EC 5.4.1.2)
 
Halobacterium sp. NRC-1

Gene: VNG1567G: Cobalt-precorrin-8x methylmutase (EC 5.4.1.2)
 
Haloferax volcanii DS2

Gene: HVO_B0049: Cobalt-precorrin-8x methylmutase (EC 5.4.1.2)
 
Halomicrobium mukohataei DSM 12286

Gene: Hmuk_1858: Cobalt-precorrin-8x methylmutase (EC 5.4.1.2)
 
Haloquadratum walsbyi DSM 16790

Gene: HQ2297A: Cobalt-precorrin-8x methylmutase (EC 5.4.1.2)
 
Halorhabdus utahensis DSM 12940
 
Halorubrum lacusprofundi ATCC 49239

Gene: Hlac_3460: Cobalt-precorrin-8x methylmutase (EC 5.4.1.2)
 
Haloterrigena turkmenica DSM 5511

Gene: Htur_1004: Cobalt-precorrin-8x methylmutase (EC 5.4.1.2)
 
Natrialba magadii ATCC 43099
 
Natronomonas pharaonis DSM 2160

Gene: NP1090A: Cobalt-precorrin-8x methylmutase (EC 5.4.1.2)
Cobalt-precorrin-8x methylmutase (EC 5.4.1.2)
cbiJ
 
Haloarcula marismortui ATCC 43049

Gene: rrnAC3021: Cobalt-precorrin-6y C5-methyltransferase (EC 2.1.1.-)
 
Halobacterium salinarum R1

Gene: OE3238F: Cobalt-precorrin-6y C5-methyltransferase (EC 2.1.1.-)
 
Halobacterium sp. NRC-1

Gene: VNG1568G: Cobalt-precorrin-6y C5-methyltransferase (EC 2.1.1.-)
 
Haloferax volcanii DS2

Gene: HVO_B0048: Cobalt-precorrin-6y C5-methyltransferase (EC 2.1.1.-)
 
Halomicrobium mukohataei DSM 12286

Gene: Hmuk_1857: Cobalt-precorrin-6y C5-methyltransferase (EC 2.1.1.-)
*
Haloquadratum walsbyi DSM 16790

Site:
position = -236
score = 4.25711
sequence = GTTGCAACCCCGGTTGGATT

Gene: HQ2298A: Cobalt-precorrin-6y C5-methyltransferase (EC 2.1.1.-)
 
Halorhabdus utahensis DSM 12940
 
Halorubrum lacusprofundi ATCC 49239

Gene: Hlac_3459: Cobalt-precorrin-6y C5-methyltransferase (EC 2.1.1.-)
 
Haloterrigena turkmenica DSM 5511

Gene: Htur_1003: Cobalt-precorrin-6y C5-methyltransferase (EC 2.1.1.-)
 
Natrialba magadii ATCC 43099
 
Natronomonas pharaonis DSM 2160

Gene: NP1088A: Cobalt-precorrin-6y C5-methyltransferase (EC 2.1.1.-)
Cobalt-precorrin-6y C5-methyltransferase (EC 2.1.1.-)
 
CRON 4.
cbiD-II
*
Haloarcula marismortui ATCC 43049

Site:
position = -37
score = 5.40567
sequence = AAAACAACTCAGCTTGTTTT

Gene: rrnAC3023: B12 biosynthesis-related protein, possible CbiD equivalent
*
Halobacterium salinarum R1

Site:
position = -44
score = 4.77874
sequence = TATGCAACCACAGTTGGGTT

Gene: OE3239R: B12 biosynthesis-related protein, possible CbiD equivalent
*
Halobacterium sp. NRC-1

Site:
position = -44
score = 4.77874
sequence = TATGCAACCACAGTTGGGTT

Gene: VNG1570H: B12 biosynthesis-related protein, possible CbiD equivalent
 
Haloferax volcanii DS2
*
Halomicrobium mukohataei DSM 12286

Site:
position = -36
score = 4.99638
sequence = AGTACAACTACACTTGTACC

Site:
position = -56
score = 4.749
sequence = ATAGCAAGCACAATTGGTGT

Gene: Hmuk_1856: B12 biosynthesis-related protein, possible CbiD equivalent
 
Haloquadratum walsbyi DSM 16790
 
Halorhabdus utahensis DSM 12940
*
Halorubrum lacusprofundi ATCC 49239

Site:
position = -33
score = 4.41593
sequence = AGATAAAGTATAGTTGAACT

Gene: Hlac_3458: B12 biosynthesis-related protein, possible CbiD equivalent
 
Haloterrigena turkmenica DSM 5511
 
Natrialba magadii ATCC 43099
*
Natronomonas pharaonis DSM 2160

Site:
position = -27
score = 5.40741
sequence = AATACAACTATACTTGATTA

Site:
position = -47
score = 4.37519
sequence = TGTACAAGCCGAATTGCTGT

Gene: NP0734A: B12 biosynthesis-related protein, possible CbiD equivalent
B12 biosynthesis-related protein, possible CbiD equivalent
 
CRON 5.
btuC
 
Haloarcula marismortui ATCC 43049

Gene: rrnAC3374: Vitamin B12 ABC transporter, permease component BtuC
 
Halobacterium salinarum R1

Gene: OE2952F: Vitamin B12 ABC transporter, permease component BtuC
 
Halobacterium sp. NRC-1

Gene: VNG1370G: Vitamin B12 ABC transporter, permease component BtuC
 
Haloferax volcanii DS2

Gene: HVO_1111: Vitamin B12 ABC transporter, permease component BtuC
*
Halomicrobium mukohataei DSM 12286

Site:
position = -21
score = 4.06726
sequence = ATCCCAACTGTGGTTGGAAC

Gene: Hmuk_2792: Vitamin B12 ABC transporter, permease component BtuC
*
Haloquadratum walsbyi DSM 16790

Site:
position = -26
score = 4.64993
sequence = ACTGCAAGTGCGTTTGTATA

Gene: HQ1627A: Vitamin B12 ABC transporter, permease component BtuC
*
Halorhabdus utahensis DSM 12940

Site:
position = -1
score = 4.60461
sequence = AATGCAACTCAACTTGTCGT

Gene: Huta_2493: Vitamin B12 ABC transporter, permease component BtuC
*
Halorubrum lacusprofundi ATCC 49239

Site:
position = -24
score = 4.28481
sequence = ACTACAAGTTTTGTTGGAGA

Gene: Hlac_0881: Vitamin B12 ABC transporter, permease component BtuC
*
Haloterrigena turkmenica DSM 5511

Site:
position = -21
score = 4.70745
sequence = AAACCAACCGTGGTTGGATC

Gene: Htur_1831: Vitamin B12 ABC transporter, permease component BtuC
*
Natrialba magadii ATCC 43099

Site:
position = -22
score = 4.9868
sequence = AAAGCAATCATGCTTGCACA

Gene: Nmag_3606: Vitamin B12 ABC transporter, permease component BtuC
*
Natronomonas pharaonis DSM 2160

Site:
position = -21
score = 4.1954
sequence = AAACCAAGCCCAGTTGCAGC

Gene: NP3816A: Vitamin B12 ABC transporter, permease component BtuC
Vitamin B12 ABC transporter, permease component BtuC
btuD
 
Haloarcula marismortui ATCC 43049

Gene: rrnAC3372: Vitamin B12 ABC transporter, ATPase component BtuD
 
Halobacterium salinarum R1

Gene: OE2955F: Vitamin B12 ABC transporter, ATPase component BtuD
 
Halobacterium sp. NRC-1

Gene: VNG1371Gm: Vitamin B12 ABC transporter, ATPase component BtuD
 
Haloferax volcanii DS2

Gene: HVO_1112: Vitamin B12 ABC transporter, ATPase component BtuD
 
Halomicrobium mukohataei DSM 12286

Gene: Hmuk_2793: Vitamin B12 ABC transporter, ATPase component BtuD
 
Haloquadratum walsbyi DSM 16790

Gene: HQ1626A: Vitamin B12 ABC transporter, ATPase component BtuD
 
Halorhabdus utahensis DSM 12940

Gene: Huta_2492: Vitamin B12 ABC transporter, ATPase component BtuD
 
Halorubrum lacusprofundi ATCC 49239

Gene: Hlac_0882: Vitamin B12 ABC transporter, ATPase component BtuD
 
Haloterrigena turkmenica DSM 5511

Gene: Htur_1832: Vitamin B12 ABC transporter, ATPase component BtuD
 
Natrialba magadii ATCC 43099

Gene: Nmag_3607: Vitamin B12 ABC transporter, ATPase component BtuD
 
Natronomonas pharaonis DSM 2160

Gene: NP3818A: Vitamin B12 ABC transporter, ATPase component BtuD
Vitamin B12 ABC transporter, ATPase component BtuD
 
CRON 6.
nrdR
 
Haloarcula marismortui ATCC 43049
 
Halobacterium salinarum R1
 
Halobacterium sp. NRC-1
 
Haloferax volcanii DS2
*
Halomicrobium mukohataei DSM 12286

Site:
position = -136
score = 4.90606
sequence = TAATCAAGTCTAATTGTACT

Gene: Hmuk_3351: Ribonucleotide reductase transcriptional regulator NrdR
 
Haloquadratum walsbyi DSM 16790
*
Halorhabdus utahensis DSM 12940

Site:
position = -133
score = 5.10158
sequence = AGTACAACTGAACTTGGACT

Gene: Huta_2339: Ribonucleotide reductase transcriptional regulator NrdR
*
Halorubrum lacusprofundi ATCC 49239

Site:
position = -136
score = 5.46877
sequence = AATACAAGTTTAGTTGTGTT

Gene: Hlac_2946: Ribonucleotide reductase transcriptional regulator NrdR
 
Haloterrigena turkmenica DSM 5511
*
Natrialba magadii ATCC 43099

Site:
position = -136
score = 3.99336
sequence = AACACAAGTGAATTTTCACT

Gene: Nmag_2658: Ribonucleotide reductase transcriptional regulator NrdR
*
Natronomonas pharaonis DSM 2160

Site:
position = -117
score = 4.259
sequence = ACACCAATTTTATTTGGAAA

Site:
position = -137
score = 4.95164
sequence = AAATCAAGTTCATTTGTACT

Gene: NP6162A: Ribonucleotide reductase transcriptional regulator NrdR
Ribonucleotide reductase transcriptional regulator NrdR
NP6164A
 
Haloarcula marismortui ATCC 43049
 
Halobacterium salinarum R1
 
Halobacterium sp. NRC-1
 
Haloferax volcanii DS2
 
Halomicrobium mukohataei DSM 12286
 
Haloquadratum walsbyi DSM 16790
 
Halorhabdus utahensis DSM 12940
 
Halorubrum lacusprofundi ATCC 49239
 
Haloterrigena turkmenica DSM 5511
 
Natrialba magadii ATCC 43099
 
Natronomonas pharaonis DSM 2160

Gene: NP6164A: hypothetical protein
hypothetical protein
nrdB2
 
Haloarcula marismortui ATCC 43049
 
Halobacterium salinarum R1
 
Halobacterium sp. NRC-1
 
Haloferax volcanii DS2
 
Halomicrobium mukohataei DSM 12286

Gene: Hmuk_3350: Ribonucleotide reductase of class Ia (aerobic), beta subunit (EC 1.17.4.1)
 
Haloquadratum walsbyi DSM 16790
 
Halorhabdus utahensis DSM 12940
 
Halorubrum lacusprofundi ATCC 49239

Gene: Hlac_2945: Ribonucleotide reductase of class Ia (aerobic), beta subunit (EC 1.17.4.1)
 
Haloterrigena turkmenica DSM 5511
 
Natrialba magadii ATCC 43099
 
Natronomonas pharaonis DSM 2160

Gene: NP6166A: Ribonucleotide reductase of class Ia (aerobic), beta subunit (EC 1.17.4.1)
Ribonucleotide reductase of class Ia (aerobic), beta subunit (EC 1.17.4.1)
nrdA2
 
Haloarcula marismortui ATCC 43049
 
Halobacterium salinarum R1
 
Halobacterium sp. NRC-1
 
Haloferax volcanii DS2
 
Halomicrobium mukohataei DSM 12286

Gene: Hmuk_3349: Ribonucleotide reductase of class Ia (aerobic), alpha subunit (EC 1.17.4.1)
 
Haloquadratum walsbyi DSM 16790
 
Halorhabdus utahensis DSM 12940
 
Halorubrum lacusprofundi ATCC 49239

Gene: Hlac_2944: Ribonucleotide reductase of class Ia (aerobic), alpha subunit (EC 1.17.4.1)
 
Haloterrigena turkmenica DSM 5511
 
Natrialba magadii ATCC 43099
 
Natronomonas pharaonis DSM 2160

Gene: NP6168A: Ribonucleotide reductase of class Ia (aerobic), alpha subunit (EC 1.17.4.1)
Ribonucleotide reductase of class Ia (aerobic), alpha subunit (EC 1.17.4.1)
nrdA1
 
Haloarcula marismortui ATCC 43049
*
Halobacterium salinarum R1

Site:
position = -153
score = 4.85074
sequence = TGATCAACTTAGATTGTACT

Site:
position = -133
score = 4.62208
sequence = TCTACAAGTTTAGTTGGTAA

Gene: OE4346R: Ribonucleotide reductase of class Ia (aerobic), alpha subunit (EC 1.17.4.1)
*
Halobacterium sp. NRC-1

Site:
position = -153
score = 4.85074
sequence = TGATCAACTTAGATTGTACT

Site:
position = -133
score = 4.62208
sequence = TCTACAAGTTTAGTTGGTAA

Gene: VNG2384G: Ribonucleotide reductase of class Ia (aerobic), alpha subunit (EC 1.17.4.1)
 
Haloferax volcanii DS2
 
Halomicrobium mukohataei DSM 12286
 
Haloquadratum walsbyi DSM 16790
 
Halorhabdus utahensis DSM 12940

Gene: Huta_2338: Ribonucleotide reductase of class Ia (aerobic), alpha subunit (EC 1.17.4.1)
 
Halorubrum lacusprofundi ATCC 49239
 
Haloterrigena turkmenica DSM 5511
 
Natrialba magadii ATCC 43099

Gene: Nmag_2657: Ribonucleotide reductase of class Ia (aerobic), alpha subunit (EC 1.17.4.1)
 
Natronomonas pharaonis DSM 2160
Ribonucleotide reductase of class Ia (aerobic), alpha subunit (EC 1.17.4.1)
nrdB1
 
Haloarcula marismortui ATCC 43049
 
Halobacterium salinarum R1

Gene: OE4345R: Ribonucleotide reductase of class Ia (aerobic), beta subunit (EC 1.17.4.1)
 
Halobacterium sp. NRC-1

Gene: VNG2383G: Ribonucleotide reductase of class Ia (aerobic), beta subunit (EC 1.17.4.1)
 
Haloferax volcanii DS2
 
Halomicrobium mukohataei DSM 12286
 
Haloquadratum walsbyi DSM 16790
 
Halorhabdus utahensis DSM 12940

Gene: Huta_2337: Ribonucleotide reductase of class Ia (aerobic), beta subunit (EC 1.17.4.1)
 
Halorubrum lacusprofundi ATCC 49239
 
Haloterrigena turkmenica DSM 5511
 
Natrialba magadii ATCC 43099

Gene: Nmag_2656: Ribonucleotide reductase of class Ia (aerobic), beta subunit (EC 1.17.4.1)
 
Natronomonas pharaonis DSM 2160
Ribonucleotide reductase of class Ia (aerobic), beta subunit (EC 1.17.4.1)
 
CRON 7.
cbiM
 
Haloarcula marismortui ATCC 43049
*
Halobacterium salinarum R1

Site:
position = -69
score = 5.23546
sequence = AATACAAATTCAGTTGTTCT

Gene: OE3319R: Substrate-specific component CbiM of cobalt ECF transporter
*
Halobacterium sp. NRC-1

Site:
position = -69
score = 5.23546
sequence = AATACAAATTCAGTTGTTCT

Gene: VNG1635G: Substrate-specific component CbiM of cobalt ECF transporter
 
Haloferax volcanii DS2
 
Halomicrobium mukohataei DSM 12286
*
Haloquadratum walsbyi DSM 16790

Site:
position = -126
score = 5.3072
sequence = AAAACAATTACGCTTGCTCT

Site:
position = -60
score = 5.53781
sequence = AGTACAAGCAAAATTGTTTT

Gene: HQ1835A: Substrate-specific component CbiM of cobalt ECF transporter
 
Halorhabdus utahensis DSM 12940
 
Halorubrum lacusprofundi ATCC 49239
 
Haloterrigena turkmenica DSM 5511
 
Natrialba magadii ATCC 43099
 
Natronomonas pharaonis DSM 2160
Substrate-specific component CbiM of cobalt ECF transporter
cbiN
 
Haloarcula marismortui ATCC 43049
 
Halobacterium salinarum R1

Gene: OE3318R: Additional substrate-specific component CbiN of cobalt ECF transporter
 
Halobacterium sp. NRC-1

Gene: VNG1634G: Additional substrate-specific component CbiN of cobalt ECF transporter
 
Haloferax volcanii DS2
 
Halomicrobium mukohataei DSM 12286
 
Haloquadratum walsbyi DSM 16790

Gene: HQ1836A: Additional substrate-specific component CbiN of cobalt ECF transporter
 
Halorhabdus utahensis DSM 12940
 
Halorubrum lacusprofundi ATCC 49239
 
Haloterrigena turkmenica DSM 5511
 
Natrialba magadii ATCC 43099
 
Natronomonas pharaonis DSM 2160
Additional substrate-specific component CbiN of cobalt ECF transporter
cbiQ
 
Haloarcula marismortui ATCC 43049
 
Halobacterium salinarum R1

Gene: OE3317R: Transmembrane component CbiQ of energizing module of cobalt ECF transporter
 
Halobacterium sp. NRC-1

Gene: VNG1632G: Transmembrane component CbiQ of energizing module of cobalt ECF transporter
 
Haloferax volcanii DS2
 
Halomicrobium mukohataei DSM 12286
 
Haloquadratum walsbyi DSM 16790

Gene: HQ1837A: Transmembrane component CbiQ of energizing module of cobalt ECF transporter
 
Halorhabdus utahensis DSM 12940
 
Halorubrum lacusprofundi ATCC 49239
 
Haloterrigena turkmenica DSM 5511
 
Natrialba magadii ATCC 43099
 
Natronomonas pharaonis DSM 2160
Transmembrane component CbiQ of energizing module of cobalt ECF transporter
cbiO
 
Haloarcula marismortui ATCC 43049
 
Halobacterium salinarum R1

Gene: OE3315R: ATPase component CbiO of energizing module of cobalt ECF transporter
 
Halobacterium sp. NRC-1

Gene: VNG1631G: ATPase component CbiO of energizing module of cobalt ECF transporter
 
Haloferax volcanii DS2
 
Halomicrobium mukohataei DSM 12286
 
Haloquadratum walsbyi DSM 16790

Gene: HQ1838A: ATPase component CbiO of energizing module of cobalt ECF transporter
 
Halorhabdus utahensis DSM 12940
 
Halorubrum lacusprofundi ATCC 49239
 
Haloterrigena turkmenica DSM 5511
 
Natrialba magadii ATCC 43099
 
Natronomonas pharaonis DSM 2160
ATPase component CbiO of energizing module of cobalt ECF transporter
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD