Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SO1758 - Shewanellaceae

Properties
Regulator type: Transcription factor
Regulator family: [Other]
Regulation mode: repressor
Biological process:
Effector:
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 11 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Shewanella oneidensis MR-1 1 1
Shewanella putrefaciens CN-32 1 1
Shewanella sp W3-18-1 1 1
Shewanella sp ANA-3 1 1
Shewanella sp MR-4 1 1
Shewanella sp MR-7 1 1
Shewanella baltica OS155 1 1
Shewanella denitrificans OS217
Shewanella frigidimarina NCIMB 400
Shewanella amazonensis SB2B 1 1
Shewanella loihica PV-4 1 1
Shewanella pealeana ATCC 700345
Shewanella halifaxensis HAW-EB4
Shewanella piezotolerans WP3
Shewanella sediminis HAW-EB3 1 1
Shewanella woodyi ATCC 51908 1 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
SO1756
*
Shewanella oneidensis MR-1

Site:
position = -104
score = 6.8068
sequence = ACTGACATGATGCTGTCAGT

Gene: SO_1756: Glyoxalase family protein
*
Shewanella putrefaciens CN-32

Site:
position = -122
score = 7.028
sequence = ACTGACATCATGCTGTCAGT

Gene: Sputcn32_1455: Glyoxalase family protein
*
Shewanella sp W3-18-1

Site:
position = -122
score = 7.028
sequence = ACTGACATCATGCTGTCAGT

Gene: Sputw3181_2647: Glyoxalase family protein
*
Shewanella sp ANA-3

Site:
position = -110
score = 6.70071
sequence = ACTGACATGATGTTGTCAGT

Gene: Shewana3_2706: Glyoxalase family protein
*
Shewanella sp MR-4

Site:
position = -110
score = 6.70071
sequence = ACTGACATGATGTTGTCAGT

Gene: Shewmr4_2540: Glyoxalase family protein
*
Shewanella sp MR-7

Site:
position = -110
score = 6.70071
sequence = ACTGACATGATGTTGTCAGT

Gene: Shewmr7_2607: Glyoxalase family protein
*
Shewanella baltica OS155

Site:
position = -121
score = 7.028
sequence = ACTGACATCATGCTGTCAGT

Gene: Sbal_1562: Glyoxalase family protein
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
*
Shewanella amazonensis SB2B

Site:
position = -114
score = 6.40294
sequence = GCTGACACCATGTTGTCAGC

Gene: Sama_1190: Glyoxalase family protein
*
Shewanella loihica PV-4

Site:
position = -105
score = 6.45551
sequence = ACTGACACTAGGCTGTCAGT

Gene: Shew_2543: Glyoxalase family protein
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
*
Shewanella sediminis HAW-EB3

Site:
position = -71
score = 6.45551
sequence = ACTGACACTACGCTGTCAGT

Gene: Ssed_2787: Glyoxalase family protein
*
Shewanella woodyi ATCC 51908

Site:
position = -100
score = 6.7614
sequence = ACTGACACTATGGTGTCAGT

Gene: Swoo_3144: Glyoxalase family protein
Glyoxalase family protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD