Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SdaR - Shewanellaceae

Properties
Regulator type: Transcription factor
Regulator family: SdaR
Regulation mode: repressor
Biological process: Glycerate utilization
Effector: Glycerate
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 14 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Shewanella oneidensis MR-1 2 1
Shewanella putrefaciens CN-32 2 1
Shewanella sp W3-18-1 2 1
Shewanella sp ANA-3 2 1
Shewanella sp MR-4 2 1
Shewanella sp MR-7 2 1
Shewanella baltica OS155 2 1
Shewanella denitrificans OS217
Shewanella frigidimarina NCIMB 400 2 1
Shewanella amazonensis SB2B
Shewanella loihica PV-4 2 1
Shewanella pealeana ATCC 700345 2 1
Shewanella halifaxensis HAW-EB4 2 1
Shewanella piezotolerans WP3 2 1
Shewanella sediminis HAW-EB3 2 1
Shewanella woodyi ATCC 51908 2 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
grtP
*
Shewanella oneidensis MR-1

Site:
position = -197
score = 6.45303
sequence = TTTTGTGCTCATGCACAAAA

Gene: SO1771: D-glycerate transporter, GntP family
*
Shewanella putrefaciens CN-32

Site:
position = -190
score = 6.80421
sequence = TTTTGTGCGCACGCACAAAA

Gene: Sputcn32_1471: D-glycerate transporter, GntP family
*
Shewanella sp W3-18-1

Site:
position = -190
score = 6.80421
sequence = TTTTGTGCGCACGCACAAAA

Gene: Sputw3181_2630: D-glycerate transporter, GntP family
*
Shewanella sp ANA-3

Site:
position = -199
score = 6.80421
sequence = TTTTGTGCGCACGCACAAAA

Gene: Shewana3_2684: D-glycerate transporter, GntP family
*
Shewanella sp MR-4

Site:
position = -200
score = 6.69422
sequence = TTTTGTGCACACGCACAAAA

Gene: Shewmr4_2518: D-glycerate transporter, GntP family
*
Shewanella sp MR-7

Site:
position = -200
score = 6.69422
sequence = TTTTGTGCACACGCACAAAA

Gene: Shewmr7_2586: D-glycerate transporter, GntP family
*
Shewanella baltica OS155

Site:
position = -204
score = 6.56302
sequence = TTTTGTGCGTGAGCACAAAA

Gene: Sbal_1576: D-glycerate transporter, GntP family
 
Shewanella denitrificans OS217
*
Shewanella frigidimarina NCIMB 400

Site:
position = -131
score = 5.98353
sequence = AGTTGTGCGTGTGCACAAAT

Gene: Sfri_2641: D-glycerate transporter, GntP family
 
Shewanella amazonensis SB2B
*
Shewanella loihica PV-4

Site:
position = -199
score = 5.38604
sequence = ATTTGGGCAAAAGCACAAAT

Gene: Shew_2533: D-glycerate transporter, GntP family
*
Shewanella pealeana ATCC 700345

Site:
position = -190
score = 6.6223
sequence = TATTGTGCGCACGCACAAAA

Gene: Spea_2713: D-glycerate transporter, GntP family
*
Shewanella halifaxensis HAW-EB4

Site:
position = -190
score = 5.9271
sequence = AACTGTGCGCACGCACAATA

Gene: Shal_2799: D-glycerate transporter, GntP family
*
Shewanella piezotolerans WP3

Site:
position = -190
score = 5.82762
sequence = AACTGTGCACGCGCACAAAT

Gene: swp_3291: D-glycerate transporter, GntP family
*
Shewanella sediminis HAW-EB3

Site:
position = -203
score = 6.70514
sequence = TTTTGTGCATACGCACAAAA

Gene: Ssed_2778: D-glycerate transporter, GntP family
*
Shewanella woodyi ATCC 51908

Site:
position = -155
score = 6.3304
sequence = TATTGTGCATGCGCACAATA

Gene: Swoo_3133: D-glycerate transporter, GntP family
D-glycerate transporter, GntP family
garK
 
Shewanella oneidensis MR-1

Gene: SO1770: Glycerate kinase (EC 2.7.1.31)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1470: Glycerate kinase (EC 2.7.1.31)
 
Shewanella sp W3-18-1

Gene: Sputw3181_2631: Glycerate kinase (EC 2.7.1.31)
 
Shewanella sp ANA-3

Gene: Shewana3_2685: Glycerate kinase (EC 2.7.1.31)
 
Shewanella sp MR-4

Gene: Shewmr4_2519: Glycerate kinase (EC 2.7.1.31)
 
Shewanella sp MR-7

Gene: Shewmr7_2587: Glycerate kinase (EC 2.7.1.31)
 
Shewanella baltica OS155

Gene: Sbal_1575: Glycerate kinase (EC 2.7.1.31)
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2642: Glycerate kinase (EC 2.7.1.31)
 
Shewanella amazonensis SB2B

Gene: Sama_3228: Glycerate kinase (EC 2.7.1.31)
 
Shewanella loihica PV-4

Gene: Shew_2534: Glycerate kinase (EC 2.7.1.31)
 
Shewanella pealeana ATCC 700345

Gene: Spea_2714: Glycerate kinase (EC 2.7.1.31)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2800: Glycerate kinase (EC 2.7.1.31)
 
Shewanella piezotolerans WP3

Gene: swp_3292: Glycerate kinase (EC 2.7.1.31)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_2779: Glycerate kinase (EC 2.7.1.31)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3134: Glycerate kinase (EC 2.7.1.31)
Glycerate kinase (EC 2.7.1.31)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD