Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HisR - Xanthomonadales

Properties
Regulator type: Transcription factor
Regulator family: TrpR
Regulation mode: repressor
Biological process: Histidine biosynthesis
Effector: Histidine
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Stenotrophomonas maltophilia K279a 9 2
Xanthomonas axonopodis pv. citri str. 306 9 2
Xanthomonas campestris pv. campestris str. ATCC 33913 9 2
Xylella fastidiosa 9a5c 9 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
hisR
*
Stenotrophomonas maltophilia K279a

Site:
position = -23
score = 7.15633
sequence = TGTACTAACGCGCTATTACA

Gene: Smlt2161: Predicted histidine repressor, TrpR family
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -28
score = 7.27186
sequence = TGTACTAACACGCTATTACA

Gene: XAC1827: Predicted histidine repressor, TrpR family
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -28
score = 7.27186
sequence = TGTACTAACACGCTATTACA

Gene: XCC1807: Predicted histidine repressor, TrpR family
*
Xylella fastidiosa 9a5c

Site:
position = -27
score = 6.21314
sequence = TGTAATAGTTCGCTATATCA

Gene: XF2221: Predicted histidine repressor, TrpR family
Predicted histidine repressor, TrpR family
 
CRON 2.
hisG
*
Stenotrophomonas maltophilia K279a

Site:
position = -384
score = 7.15633
sequence = TGTACTAACGCGCTATTACA

Gene: Smlt2162: ATP phosphoribosyltransferase (EC 2.4.2.17)
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -364
score = 7.27186
sequence = TGTACTAACACGCTATTACA

Gene: XAC1828: ATP phosphoribosyltransferase (EC 2.4.2.17)
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -364
score = 7.27186
sequence = TGTACTAACACGCTATTACA

Gene: XCC1808: ATP phosphoribosyltransferase (EC 2.4.2.17)
*
Xylella fastidiosa 9a5c

Site:
position = -362
score = 6.21314
sequence = TGTAATAGTTCGCTATATCA

Gene: XF2220: ATP phosphoribosyltransferase (EC 2.4.2.17)
ATP phosphoribosyltransferase (EC 2.4.2.17)
hisD
 
Stenotrophomonas maltophilia K279a

Gene: Smlt2163: Histidinol dehydrogenase (EC 1.1.1.23)
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC1829: Histidinol dehydrogenase (EC 1.1.1.23)
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC1809: Histidinol dehydrogenase (EC 1.1.1.23)
 
Xylella fastidiosa 9a5c

Gene: XF2219: Histidinol dehydrogenase (EC 1.1.1.23)
Histidinol dehydrogenase (EC 1.1.1.23)
hisC
 
Stenotrophomonas maltophilia K279a

Gene: Smlt2164: Histidinol-phosphate aminotransferase (EC 2.6.1.9)
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC1830: Histidinol-phosphate aminotransferase (EC 2.6.1.9)
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC1810: Histidinol-phosphate aminotransferase (EC 2.6.1.9)
 
Xylella fastidiosa 9a5c

Gene: XF2218: Histidinol-phosphate aminotransferase (EC 2.6.1.9)
Histidinol-phosphate aminotransferase (EC 2.6.1.9)
hisB
 
Stenotrophomonas maltophilia K279a

Gene: Smlt2165: Histidinol-phosphatase (EC 3.1.3.15) / Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC1831: Histidinol-phosphatase (EC 3.1.3.15) / Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC1811: Histidinol-phosphatase (EC 3.1.3.15) / Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
 
Xylella fastidiosa 9a5c

Gene: XF2217: Histidinol-phosphatase (EC 3.1.3.15) / Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
Histidinol-phosphatase (EC 3.1.3.15) / Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
hisH
 
Stenotrophomonas maltophilia K279a

Gene: Smlt2166: Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC1832: Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC1812: Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
 
Xylella fastidiosa 9a5c

Gene: XF2216: Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
hisA
 
Stenotrophomonas maltophilia K279a

Gene: Smlt2167: Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC1833: Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC1813: Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
 
Xylella fastidiosa 9a5c

Gene: XF2215: Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
hisF
 
Stenotrophomonas maltophilia K279a

Gene: Smlt2168: Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC1834: Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC1814: Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
 
Xylella fastidiosa 9a5c

Gene: XF2214: Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
hisIE
 
Stenotrophomonas maltophilia K279a

Gene: Smlt2169: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC1835: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC1815: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
 
Xylella fastidiosa 9a5c

Gene: XF2213: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD