Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HisR - Listeriaceae

Properties
Regulator type: Transcription factor
Regulator family: TrpR
Regulation mode: repressor
Biological process: Histidine biosynthesis
Effector: Histidine
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Listeria innocua Clip11262 10 2
Listeria monocytogenes EGD-e 10 2
Listeria seeligeri serovar 1/2b str. SLCC3954 10 2
Listeria welshimeri serovar 6b str. SLCC5334 10 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
hisJ
*
Listeria innocua Clip11262

Site:
position = -116
score = 6.14584
sequence = CATATTAGCACGTTAAAGTG

Gene: lin0579: Histidinol-phosphatase (EC 3.1.3.15)
*
Listeria monocytogenes EGD-e

Site:
position = -116
score = 6.06868
sequence = CATATTAGCACGTTAAAGCG

Gene: lmo0570: Histidinol-phosphatase (EC 3.1.3.15)
*
Listeria seeligeri serovar 1/2b str. SLCC3954

Site:
position = -107
score = 6.06868
sequence = CATATTAGCACGTTAAAGCG

Gene: lse_0478: Histidinol-phosphatase (EC 3.1.3.15)
*
Listeria welshimeri serovar 6b str. SLCC5334

Site:
position = -104
score = 5.78764
sequence = CATATTAGCACGTTAAAGCA

Gene: lwe0536: Histidinol-phosphatase (EC 3.1.3.15)
Histidinol-phosphatase (EC 3.1.3.15)
 
CRON 2.
hisZ
*
Listeria innocua Clip11262

Site:
position = -55
score = 6.14584
sequence = CACTTTAACGTGCTAATATG

Gene: lin0578: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
*
Listeria monocytogenes EGD-e

Site:
position = -55
score = 6.06868
sequence = CGCTTTAACGTGCTAATATG

Gene: lmo0569: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
*
Listeria seeligeri serovar 1/2b str. SLCC3954

Site:
position = -54
score = 6.06868
sequence = CGCTTTAACGTGCTAATATG

Gene: lse_0477: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
*
Listeria welshimeri serovar 6b str. SLCC5334

Site:
position = -55
score = 5.78764
sequence = TGCTTTAACGTGCTAATATG

Gene: lwe0535: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
hisG
 
Listeria innocua Clip11262

Gene: lin0577: ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17)
 
Listeria monocytogenes EGD-e

Gene: lmo0568: ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17)
 
Listeria seeligeri serovar 1/2b str. SLCC3954

Gene: lse_0476: ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17)
 
Listeria welshimeri serovar 6b str. SLCC5334

Gene: lwe0534: ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17)
ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17)
hisD
 
Listeria innocua Clip11262

Gene: lin0576: Histidinol dehydrogenase (EC 1.1.1.23)
 
Listeria monocytogenes EGD-e

Gene: lmo0567: Histidinol dehydrogenase (EC 1.1.1.23)
 
Listeria seeligeri serovar 1/2b str. SLCC3954

Gene: lse_0475: Histidinol dehydrogenase (EC 1.1.1.23)
 
Listeria welshimeri serovar 6b str. SLCC5334

Gene: lwe0533: Histidinol dehydrogenase (EC 1.1.1.23)
Histidinol dehydrogenase (EC 1.1.1.23)
hisB
 
Listeria innocua Clip11262

Gene: lin0575: Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
 
Listeria monocytogenes EGD-e

Gene: lmo0566: Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
 
Listeria seeligeri serovar 1/2b str. SLCC3954

Gene: lse_0474: Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
 
Listeria welshimeri serovar 6b str. SLCC5334

Gene: lwe0532: Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
hisH
 
Listeria innocua Clip11262

Gene: lin0574: Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
 
Listeria monocytogenes EGD-e

Gene: lmo0565: Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
 
Listeria seeligeri serovar 1/2b str. SLCC3954

Gene: lse_0473: Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
 
Listeria welshimeri serovar 6b str. SLCC5334

Gene: lwe0531: Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
hisA
 
Listeria innocua Clip11262

Gene: lin0573: Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
 
Listeria monocytogenes EGD-e

Gene: lmo0564: Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
 
Listeria seeligeri serovar 1/2b str. SLCC3954

Gene: lse_0472: Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
 
Listeria welshimeri serovar 6b str. SLCC5334

Gene: lwe0530: Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
hisF
 
Listeria innocua Clip11262

Gene: lin0572: Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
 
Listeria monocytogenes EGD-e

Gene: lmo0563: Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
 
Listeria seeligeri serovar 1/2b str. SLCC3954

Gene: lse_0471: Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
 
Listeria welshimeri serovar 6b str. SLCC5334

Gene: lwe0529: Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
hisI
 
Listeria innocua Clip11262

Gene: lin0571: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)
 
Listeria monocytogenes EGD-e

Gene: lmo0562: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)
 
Listeria seeligeri serovar 1/2b str. SLCC3954

Gene: lse_0470: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)
 
Listeria welshimeri serovar 6b str. SLCC5334

Gene: lwe0528: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)
Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)
hisE
 
Listeria innocua Clip11262

Gene: lin0570: Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
 
Listeria monocytogenes EGD-e

Gene: lmo0561: Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
 
Listeria seeligeri serovar 1/2b str. SLCC3954

Gene: lse_0469: Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
 
Listeria welshimeri serovar 6b str. SLCC5334

Gene: lwe0527: Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD