Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PUR - Shewanellaceae

Properties
Regulator type: Transcription factor
Regulator family: [Other]
Regulation mode:
Biological process: Purine metabolism
Effector:
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 60 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Shewanella oneidensis MR-1 9 4
Shewanella putrefaciens CN-32 9 4
Shewanella sp W3-18-1 9 4
Shewanella sp ANA-3 9 4
Shewanella sp MR-4 9 4
Shewanella sp MR-7 9 4
Shewanella baltica OS155 9 4
Shewanella denitrificans OS217 4 2
Shewanella frigidimarina NCIMB 400 7 3
Shewanella amazonensis SB2B 7 3
Shewanella loihica PV-4 8 4
Shewanella pealeana ATCC 700345 8 4
Shewanella halifaxensis HAW-EB4 8 4
Shewanella piezotolerans WP3 8 4
Shewanella sediminis HAW-EB3 8 4
Shewanella woodyi ATCC 51908 8 4
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
purM
*
Shewanella oneidensis MR-1

Site:
position = -31
score = 5.61154
sequence = TAGAATACGGCCGCATAAAA

Gene: SO_2760: Phosphoribosylformylglycinamidine cyclo-ligase (EC 6.3.3.1)
*
Shewanella putrefaciens CN-32

Site:
position = -52
score = 5.59304
sequence = TAGAATACCGCCGCATAAAA

Gene: Sputcn32_1596: Phosphoribosylformylglycinamidine cyclo-ligase (EC 6.3.3.1)
*
Shewanella sp W3-18-1

Site:
position = -52
score = 5.59304
sequence = TAGAATACCGCCGCATAAAA

Gene: Sputw3181_2426: Phosphoribosylformylglycinamidine cyclo-ligase (EC 6.3.3.1)
*
Shewanella sp ANA-3

Site:
position = -52
score = 5.59304
sequence = TAGAATACCGCCGCATAAAA

Gene: Shewana3_2545: Phosphoribosylformylglycinamidine cyclo-ligase (EC 6.3.3.1)
*
Shewanella sp MR-4

Site:
position = -52
score = 5.59304
sequence = TAGAATACCGCCGCATAAAA

Gene: Shewmr4_2380: Phosphoribosylformylglycinamidine cyclo-ligase (EC 6.3.3.1)
*
Shewanella sp MR-7

Site:
position = -52
score = 5.59304
sequence = TAGAATACCGCCGCATAAAA

Gene: Shewmr7_2452: Phosphoribosylformylglycinamidine cyclo-ligase (EC 6.3.3.1)
*
Shewanella baltica OS155

Site:
position = -52
score = 5.59304
sequence = TAGAATACCGCCGCATAAAA

Gene: Sbal_1735: Phosphoribosylformylglycinamidine cyclo-ligase (EC 6.3.3.1)
*
Shewanella denitrificans OS217

Site:
position = -51
score = 5.76893
sequence = TAGAATGCCGCCGCATAAAA

Gene: Sden_2094: Phosphoribosylformylglycinamidine cyclo-ligase (EC 6.3.3.1)
*
Shewanella frigidimarina NCIMB 400

Site:
position = -53
score = 5.1681
sequence = TAGAATATTGCCGCATAAAA

Gene: Sfri_1452: Phosphoribosylformylglycinamidine cyclo-ligase (EC 6.3.3.1)
*
Shewanella amazonensis SB2B

Site:
position = -53
score = 5.03697
sequence = TAGAATACGGCCCCAATAAA

Gene: Sama_2097: Phosphoribosylformylglycinamidine cyclo-ligase (EC 6.3.3.1)
*
Shewanella loihica PV-4

Site:
position = -52
score = 5.41009
sequence = TAGAATAGCGCCGCATAAAA

Gene: Shew_1513: Phosphoribosylformylglycinamidine cyclo-ligase (EC 6.3.3.1)
*
Shewanella pealeana ATCC 700345

Site:
position = -58
score = 4.96671
sequence = TAGAATGGCGCCGCGTAAAA

Gene: Spea_2577: Phosphoribosylformylglycinamidine cyclo-ligase (EC 6.3.3.1)
*
Shewanella halifaxensis HAW-EB4

Site:
position = -59
score = 5.35164
sequence = TAGAATGACGCCGCATAAAA

Gene: Shal_1680: Phosphoribosylformylglycinamidine cyclo-ligase (EC 6.3.3.1)
*
Shewanella piezotolerans WP3

Site:
position = -57
score = 5.41009
sequence = TAGAATAGCGCCGCATAAAA

Gene: swp_1818: Phosphoribosylformylglycinamidine cyclo-ligase (EC 6.3.3.1)
*
Shewanella sediminis HAW-EB3

Site:
position = -62
score = 5.41009
sequence = TAGAATAGCGCCGCATAAAA

Gene: Ssed_1845: Phosphoribosylformylglycinamidine cyclo-ligase (EC 6.3.3.1)
*
Shewanella woodyi ATCC 51908

Site:
position = -53
score = 5.58597
sequence = TAGAATGGCGCCGCATAAAA

Gene: Swoo_2744: Phosphoribosylformylglycinamidine cyclo-ligase (EC 6.3.3.1)
Phosphoribosylformylglycinamidine cyclo-ligase (EC 6.3.3.1)
purN
 
Shewanella oneidensis MR-1

Gene: SO_2761: Phosphoribosylglycinamide formyltransferase (EC 2.1.2.2)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1595: Phosphoribosylglycinamide formyltransferase (EC 2.1.2.2)
 
Shewanella sp W3-18-1

Gene: Sputw3181_2427: Phosphoribosylglycinamide formyltransferase (EC 2.1.2.2)
 
Shewanella sp ANA-3

Gene: Shewana3_2546: Phosphoribosylglycinamide formyltransferase (EC 2.1.2.2)
 
Shewanella sp MR-4

Gene: Shewmr4_2381: Phosphoribosylglycinamide formyltransferase (EC 2.1.2.2)
 
Shewanella sp MR-7

Gene: Shewmr7_2453: Phosphoribosylglycinamide formyltransferase (EC 2.1.2.2)
 
Shewanella baltica OS155

Gene: Sbal_1734: Phosphoribosylglycinamide formyltransferase (EC 2.1.2.2)
 
Shewanella denitrificans OS217

Gene: Sden_2095: Phosphoribosylglycinamide formyltransferase (EC 2.1.2.2)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_1451: Phosphoribosylglycinamide formyltransferase (EC 2.1.2.2)
 
Shewanella amazonensis SB2B

Gene: Sama_2098: Phosphoribosylglycinamide formyltransferase (EC 2.1.2.2)
 
Shewanella loihica PV-4

Gene: Shew_1512: Phosphoribosylglycinamide formyltransferase (EC 2.1.2.2)
 
Shewanella pealeana ATCC 700345

Gene: Spea_2578: Phosphoribosylglycinamide formyltransferase (EC 2.1.2.2)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_1679: Phosphoribosylglycinamide formyltransferase (EC 2.1.2.2)
 
Shewanella piezotolerans WP3

Gene: swp_1817: Phosphoribosylglycinamide formyltransferase (EC 2.1.2.2)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1844: Phosphoribosylglycinamide formyltransferase (EC 2.1.2.2)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_2745: Phosphoribosylglycinamide formyltransferase (EC 2.1.2.2)
Phosphoribosylglycinamide formyltransferase (EC 2.1.2.2)
 
CRON 2.
purE
*
Shewanella oneidensis MR-1

Site:
position = -113
score = 4.84714
sequence = TATTATTCTGCGCCATGATG

Gene: SO_3554: Phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)
*
Shewanella putrefaciens CN-32

Site:
position = -113
score = 4.31554
sequence = TATTATTCTGCGCCATGGTG

Gene: Sputcn32_1041: Phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)
*
Shewanella sp W3-18-1

Site:
position = -113
score = 4.84714
sequence = TATTATTCTGCGCCATGATG

Gene: Sputw3181_3124: Phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)
*
Shewanella sp ANA-3

Site:
position = -113
score = 4.84714
sequence = TATTATTCTGCGCCATGATG

Gene: Shewana3_3155: Phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)
*
Shewanella sp MR-4

Site:
position = -113
score = 4.84714
sequence = TATTATTCTGCGCCATGATG

Gene: Shewmr4_2975: Phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)
*
Shewanella sp MR-7

Site:
position = -113
score = 4.84714
sequence = TATTATTCTGCGCCATGATG

Gene: Shewmr7_3057: Phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)
*
Shewanella baltica OS155

Site:
position = -113
score = 4.72916
sequence = TATTATTCAGCGCCATGATG

Gene: Sbal_1036: Phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)
 
Shewanella denitrificans OS217

Gene: Sden_1224: Phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_1076: Phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)
 
Shewanella amazonensis SB2B

Gene: Sama_1064: Phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)
 
Shewanella loihica PV-4

Gene: Shew_1248: Phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)
 
Shewanella pealeana ATCC 700345

Gene: Spea_1211: Phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_1245: Phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)
 
Shewanella piezotolerans WP3

Gene: swp_1396: Phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1333: Phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3321: Phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)
Phosphoribosylaminoimidazole carboxylase catalytic subunit (EC 4.1.1.21)
purK
 
Shewanella oneidensis MR-1

Gene: SO_3555: Phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1040: Phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21)
 
Shewanella sp W3-18-1

Gene: Sputw3181_3125: Phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21)
 
Shewanella sp ANA-3

Gene: Shewana3_3156: Phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21)
 
Shewanella sp MR-4

Gene: Shewmr4_2976: Phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21)
 
Shewanella sp MR-7

Gene: Shewmr7_3058: Phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21)
 
Shewanella baltica OS155

Gene: Sbal_1035: Phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21)
 
Shewanella denitrificans OS217

Gene: Sden_1223: Phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_1075: Phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21)
 
Shewanella amazonensis SB2B

Gene: Sama_1063: Phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21)
 
Shewanella loihica PV-4

Gene: Shew_1249: Phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21)
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3322: Phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21)
Phosphoribosylaminoimidazole carboxylase ATPase subunit (EC 4.1.1.21)
 
CRON 3.
tsx
 
Shewanella oneidensis MR-1

Gene: SO_1215: nucleoside-specific channel-forming protein, Tsx
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2823: nucleoside-specific channel-forming protein, Tsx
 
Shewanella sp W3-18-1

Gene: Sputw3181_1188: nucleoside-specific channel-forming protein, Tsx
 
Shewanella sp ANA-3

Gene: Shewana3_1040: nucleoside-specific channel-forming protein, Tsx
 
Shewanella sp MR-4

Gene: Shewmr4_1036: nucleoside-specific channel-forming protein, Tsx
 
Shewanella sp MR-7

Gene: Shewmr7_1101: nucleoside-specific channel-forming protein, Tsx
 
Shewanella baltica OS155

Gene: Sbal_3228: nucleoside-specific channel-forming protein, Tsx
 
Shewanella denitrificans OS217

Gene: Sden_1024: nucleoside-specific channel-forming protein, Tsx
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_1001: nucleoside-specific channel-forming protein, Tsx
 
Shewanella amazonensis SB2B
*
Shewanella loihica PV-4

Site:
position = -75
score = 4.5802
sequence = TAAAATGCGGCGCCAACAAA

Gene: Shew_2816: nucleoside-specific channel-forming protein, Tsx
*
Shewanella pealeana ATCC 700345

Site:
position = -80
score = 4.96671
sequence = TAGAATGCGACGCCATAAAA

Gene: Spea_3049: nucleoside-specific channel-forming protein, Tsx
*
Shewanella halifaxensis HAW-EB4

Site:
position = -81
score = 5.26849
sequence = TAAAATGCGGCACCATAAAA

Gene: Shal_3137: nucleoside-specific channel-forming protein, Tsx
*
Shewanella piezotolerans WP3

Site:
position = -78
score = 5.51048
sequence = TAAAATGCGGCGCCATAAAA

Gene: swp_1228: nucleoside-specific channel-forming protein, Tsx
*
Shewanella sediminis HAW-EB3

Site:
position = -77
score = 4.73689
sequence = TAAAATGCGGCACGATAAAA

Gene: Ssed_3379: nucleoside-specific channel-forming protein, Tsx
*
Shewanella woodyi ATCC 51908

Site:
position = -79
score = 5.51048
sequence = TAAAATGCGGCGCCATAAAA

Gene: Swoo_3550: nucleoside-specific channel-forming protein, Tsx
nucleoside-specific channel-forming protein, Tsx
 
CRON 4.
gcvT
*
Shewanella oneidensis MR-1

Site:
position = -228
score = 5.63504
sequence = TATAATTTCGCCGCATTTTA

Gene: SO_0779: Aminomethyltransferase (glycine cleavage system T protein) (EC 2.1.2.10)
*
Shewanella putrefaciens CN-32

Site:
position = -84
score = 5.63504
sequence = TATAATTTCGCCGCATTTTA

Gene: Sputcn32_3211: Aminomethyltransferase (glycine cleavage system T protein) (EC 2.1.2.10)
*
Shewanella sp W3-18-1

Site:
position = -84
score = 5.63504
sequence = TATAATTTCGCCGCATTTTA

Gene: Sputw3181_0730: Aminomethyltransferase (glycine cleavage system T protein) (EC 2.1.2.10)
*
Shewanella sp ANA-3

Site:
position = -228
score = 5.63504
sequence = TATAATTTCGCCGCATTTTA

Gene: Shewana3_3501: Aminomethyltransferase (glycine cleavage system T protein) (EC 2.1.2.10)
*
Shewanella sp MR-4

Site:
position = -230
score = 5.63504
sequence = TATAATTTCGCCGCATTTTA

Gene: Shewmr4_3331: Aminomethyltransferase (glycine cleavage system T protein) (EC 2.1.2.10)
*
Shewanella sp MR-7

Site:
position = -229
score = 5.63504
sequence = TATAATTTCGCCGCATTTTA

Gene: Shewmr7_0622: Aminomethyltransferase (glycine cleavage system T protein) (EC 2.1.2.10)
*
Shewanella baltica OS155

Site:
position = -280
score = 5.63504
sequence = TATAATTTCGCCGCATTTTA

Gene: Sbal_0617: Aminomethyltransferase (glycine cleavage system T protein) (EC 2.1.2.10)
 
Shewanella denitrificans OS217

Gene: Sden_0833: Aminomethyltransferase (glycine cleavage system T protein) (EC 2.1.2.10)
*
Shewanella frigidimarina NCIMB 400

Site:
position = -62
score = 4.19922
sequence = ATAATTTTGGCCGCATTTTA

Gene: Sfri_3151: Aminomethyltransferase (glycine cleavage system T protein) (EC 2.1.2.10)
*
Shewanella amazonensis SB2B

Site:
position = -73
score = 5.63504
sequence = TATAATTTCGCCGCATTTTA

Gene: Sama_2721: Aminomethyltransferase (glycine cleavage system T protein) (EC 2.1.2.10)
*
Shewanella loihica PV-4

Site:
position = -302
score = 5.31068
sequence = TATAATTTCGCCGCATTTTG

Gene: Shew_3064: Aminomethyltransferase (glycine cleavage system T protein) (EC 2.1.2.10)
*
Shewanella pealeana ATCC 700345

Site:
position = -164
score = 5.63504
sequence = TATAATTTCGCCGCATTTTA

Gene: Spea_3303: Aminomethyltransferase (glycine cleavage system T protein) (EC 2.1.2.10)
*
Shewanella halifaxensis HAW-EB4

Site:
position = -144
score = 5.63504
sequence = TATAATTTCGCCGCATTTTA

Gene: Shal_3375: Aminomethyltransferase (glycine cleavage system T protein) (EC 2.1.2.10)
*
Shewanella piezotolerans WP3

Site:
position = -94
score = 5.63504
sequence = TATAATTTCGCCGCATTTTA

Gene: swp_0913: Aminomethyltransferase (glycine cleavage system T protein) (EC 2.1.2.10)
*
Shewanella sediminis HAW-EB3

Site:
position = -144
score = 5.31068
sequence = TATAATTTCGCCGCATTTTG

Gene: Ssed_3675: Aminomethyltransferase (glycine cleavage system T protein) (EC 2.1.2.10)
*
Shewanella woodyi ATCC 51908

Site:
position = -160
score = 5.63504
sequence = TATAATTTCGCCGCATTTTA

Gene: Swoo_3969: Aminomethyltransferase (glycine cleavage system T protein) (EC 2.1.2.10)
Aminomethyltransferase (glycine cleavage system T protein) (EC 2.1.2.10)
gcvH
 
Shewanella oneidensis MR-1

Gene: SO_0780: Glycine cleavage system H protein
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_3210: Glycine cleavage system H protein
 
Shewanella sp W3-18-1

Gene: Sputw3181_0731: Glycine cleavage system H protein
 
Shewanella sp ANA-3

Gene: Shewana3_3500: Glycine cleavage system H protein
 
Shewanella sp MR-4

Gene: Shewmr4_3330: Glycine cleavage system H protein
 
Shewanella sp MR-7

Gene: Shewmr7_0623: Glycine cleavage system H protein
 
Shewanella baltica OS155

Gene: Sbal_0618: Glycine cleavage system H protein
 
Shewanella denitrificans OS217

Gene: Sden_0834: Glycine cleavage system H protein
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_3150: Glycine cleavage system H protein
 
Shewanella amazonensis SB2B

Gene: Sama_2720: Glycine cleavage system H protein
 
Shewanella loihica PV-4

Gene: Shew_3063: Glycine cleavage system H protein
 
Shewanella pealeana ATCC 700345

Gene: Spea_3302: Glycine cleavage system H protein
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_3374: Glycine cleavage system H protein
 
Shewanella piezotolerans WP3

Gene: swp_0914: Glycine cleavage system H protein
 
Shewanella sediminis HAW-EB3

Gene: Ssed_3674: Glycine cleavage system H protein
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3968: Glycine cleavage system H protein
Glycine cleavage system H protein
gcvP
 
Shewanella oneidensis MR-1

Gene: SO_0781: Glycine dehydrogenase [decarboxylating] (glycine cleavage system P protein) (EC 1.4.4.2)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_3209: Glycine dehydrogenase [decarboxylating] (glycine cleavage system P protein) (EC 1.4.4.2)
 
Shewanella sp W3-18-1

Gene: Sputw3181_0732: Glycine dehydrogenase [decarboxylating] (glycine cleavage system P protein) (EC 1.4.4.2)
 
Shewanella sp ANA-3

Gene: Shewana3_3499: Glycine dehydrogenase [decarboxylating] (glycine cleavage system P protein) (EC 1.4.4.2)
 
Shewanella sp MR-4

Gene: Shewmr4_3329: Glycine dehydrogenase [decarboxylating] (glycine cleavage system P protein) (EC 1.4.4.2)
 
Shewanella sp MR-7

Gene: Shewmr7_0624: Glycine dehydrogenase [decarboxylating] (glycine cleavage system P protein) (EC 1.4.4.2)
 
Shewanella baltica OS155

Gene: Sbal_0619: Glycine dehydrogenase [decarboxylating] (glycine cleavage system P protein) (EC 1.4.4.2)
 
Shewanella denitrificans OS217

Gene: Sden_0835: Glycine dehydrogenase [decarboxylating] (glycine cleavage system P protein) (EC 1.4.4.2)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_3149: Glycine dehydrogenase [decarboxylating] (glycine cleavage system P protein) (EC 1.4.4.2)
 
Shewanella amazonensis SB2B

Gene: Sama_2719: Glycine dehydrogenase [decarboxylating] (glycine cleavage system P protein) (EC 1.4.4.2)
 
Shewanella loihica PV-4

Gene: Shew_3062: Glycine dehydrogenase [decarboxylating] (glycine cleavage system P protein) (EC 1.4.4.2)
 
Shewanella pealeana ATCC 700345

Gene: Spea_3301: Glycine dehydrogenase [decarboxylating] (glycine cleavage system P protein) (EC 1.4.4.2)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_3373: Glycine dehydrogenase [decarboxylating] (glycine cleavage system P protein) (EC 1.4.4.2)
 
Shewanella piezotolerans WP3

Gene: swp_0915: Glycine dehydrogenase [decarboxylating] (glycine cleavage system P protein) (EC 1.4.4.2)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_3673: Glycine dehydrogenase [decarboxylating] (glycine cleavage system P protein) (EC 1.4.4.2)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3967: Glycine dehydrogenase [decarboxylating] (glycine cleavage system P protein) (EC 1.4.4.2)
Glycine dehydrogenase [decarboxylating] (glycine cleavage system P protein) (EC 1.4.4.2)
 
CRON 5.
guaB
*
Shewanella oneidensis MR-1

Site:
position = -59
score = 4.52836
sequence = TATAATCCCGCCGCAATATT

Gene: SO_3293: Inosine-5'-monophosphate dehydrogenase (EC 1.1.1.205)
*
Shewanella putrefaciens CN-32

Site:
position = -58
score = 4.52836
sequence = TATAATCCCGCCGCAATATT

Gene: Sputcn32_2646: Inosine-5'-monophosphate dehydrogenase (EC 1.1.1.205)
*
Shewanella sp W3-18-1

Site:
position = -58
score = 4.52836
sequence = TATAATCCCGCCGCAATATT

Gene: Sputw3181_1361: Inosine-5'-monophosphate dehydrogenase (EC 1.1.1.205)
*
Shewanella sp ANA-3

Site:
position = -59
score = 4.52836
sequence = TATAATCCCGCCGCAATATT

Gene: Shewana3_1235: Inosine-5'-monophosphate dehydrogenase (EC 1.1.1.205)
*
Shewanella sp MR-4

Site:
position = -59
score = 4.52836
sequence = TATAATCCCGCCGCAATATT

Gene: Shewmr4_1234: Inosine-5'-monophosphate dehydrogenase (EC 1.1.1.205)
*
Shewanella sp MR-7

Site:
position = -59
score = 4.52836
sequence = TATAATCCCGCCGCAATATT

Gene: Shewmr7_1305: Inosine-5'-monophosphate dehydrogenase (EC 1.1.1.205)
*
Shewanella baltica OS155

Site:
position = -58
score = 4.52836
sequence = TATAATCCCGCCGCAATATT

Gene: Sbal_2984: Inosine-5'-monophosphate dehydrogenase (EC 1.1.1.205)
*
Shewanella denitrificans OS217

Site:
position = -57
score = 4.3454
sequence = TATAATCTCGCCGCAATATT

Gene: Sden_1269: Inosine-5'-monophosphate dehydrogenase (EC 1.1.1.205)
*
Shewanella frigidimarina NCIMB 400

Site:
position = -55
score = 4.3454
sequence = TATAATCTCGCCGCAATATT

Gene: Sfri_1137: Inosine-5'-monophosphate dehydrogenase (EC 1.1.1.205)
*
Shewanella amazonensis SB2B

Site:
position = -57
score = 5.05996
sequence = TATAATGCCGCCGCAATATT

Gene: Sama_2359: Inosine-5'-monophosphate dehydrogenase (EC 1.1.1.205)
*
Shewanella loihica PV-4

Site:
position = -56
score = 4.52836
sequence = TATAATCCCGCCGCAATATT

Gene: Shew_1297: Inosine-5'-monophosphate dehydrogenase (EC 1.1.1.205)
*
Shewanella pealeana ATCC 700345

Site:
position = -56
score = 4.3454
sequence = TATAATCTCGCCGCAATATT

Gene: Spea_1313: Inosine-5'-monophosphate dehydrogenase (EC 1.1.1.205)
*
Shewanella halifaxensis HAW-EB4

Site:
position = -56
score = 4.3454
sequence = TATAATCTCGCCGCAATATT

Gene: Shal_1376: Inosine-5'-monophosphate dehydrogenase (EC 1.1.1.205)
*
Shewanella piezotolerans WP3

Site:
position = -56
score = 4.3454
sequence = TATAATCTCGCCGCAATATT

Gene: swp_1463: Inosine-5'-monophosphate dehydrogenase (EC 1.1.1.205)
*
Shewanella sediminis HAW-EB3

Site:
position = -58
score = 4.52836
sequence = TATAATCCCGCCGCAATATT

Gene: Ssed_3124: Inosine-5'-monophosphate dehydrogenase (EC 1.1.1.205)
*
Shewanella woodyi ATCC 51908

Site:
position = -57
score = 4.52836
sequence = TATAATCCCGCCGCAATATT

Gene: Swoo_1559: Inosine-5'-monophosphate dehydrogenase (EC 1.1.1.205)
Inosine-5'-monophosphate dehydrogenase (EC 1.1.1.205)
guaA
 
Shewanella oneidensis MR-1

Gene: SO_3292: GMP synthase [glutamine-hydrolyzing] (EC 6.3.5.2)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2645: GMP synthase [glutamine-hydrolyzing] (EC 6.3.5.2)
 
Shewanella sp W3-18-1

Gene: Sputw3181_1362: GMP synthase [glutamine-hydrolyzing] (EC 6.3.5.2)
 
Shewanella sp ANA-3

Gene: Shewana3_1236: GMP synthase [glutamine-hydrolyzing] (EC 6.3.5.2)
 
Shewanella sp MR-4

Gene: Shewmr4_1235: GMP synthase [glutamine-hydrolyzing] (EC 6.3.5.2)
 
Shewanella sp MR-7

Gene: Shewmr7_1306: GMP synthase [glutamine-hydrolyzing] (EC 6.3.5.2)
 
Shewanella baltica OS155

Gene: Sbal_2983: GMP synthase [glutamine-hydrolyzing] (EC 6.3.5.2)
 
Shewanella denitrificans OS217

Gene: Sden_1270: GMP synthase [glutamine-hydrolyzing] (EC 6.3.5.2)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_1138: GMP synthase [glutamine-hydrolyzing] (EC 6.3.5.2)
 
Shewanella amazonensis SB2B

Gene: Sama_2358: GMP synthase [glutamine-hydrolyzing] (EC 6.3.5.2)
 
Shewanella loihica PV-4

Gene: Shew_1298: GMP synthase [glutamine-hydrolyzing] (EC 6.3.5.2)
 
Shewanella pealeana ATCC 700345

Gene: Spea_1314: GMP synthase [glutamine-hydrolyzing] (EC 6.3.5.2)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_1377: GMP synthase [glutamine-hydrolyzing] (EC 6.3.5.2)
 
Shewanella piezotolerans WP3

Gene: swp_1464: GMP synthase [glutamine-hydrolyzing] (EC 6.3.5.2)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_3123: GMP synthase [glutamine-hydrolyzing] (EC 6.3.5.2)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_1560: GMP synthase [glutamine-hydrolyzing] (EC 6.3.5.2)
GMP synthase [glutamine-hydrolyzing] (EC 6.3.5.2)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD