Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HisR - Thermoanaerobacterales

Properties
Regulator type: Transcription factor
Regulator family: TrpR
Regulation mode: repressor
Biological process: Histidine biosynthesis
Effector: Histidine
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Anaerocellum thermophilum DSM 6725 9 1
Caldicellulosiruptor saccharolyticus DSM 8903 9 1
Carboxydothermus hydrogenoformans Z-2901 10 2
Moorella thermoacetica ATCC 39073 8 1
Thermoanaerobacter ethanolicus X514 9 1
Thermoanaerobacter italicus Ab9 9 1
Thermoanaerobacter tengcongensis MB4 9 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
hisZ
*
Anaerocellum thermophilum DSM 6725

Site:
position = -36
score = 5.80169
sequence = CACTTCATTATGATAAAGTA

Gene: Athe_1480: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
*
Caldicellulosiruptor saccharolyticus DSM 8903

Site:
position = -37
score = 5.56306
sequence = CACTTCATCATGATAAAGCA

Gene: Csac_2027: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
 
Carboxydothermus hydrogenoformans Z-2901

Gene: CHY_1083: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
*
Moorella thermoacetica ATCC 39073

Site:
position = -32
score = 5.39704
sequence = TACGTTAACATAGTAAAGTA

Gene: Moth_2037: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
*
Thermoanaerobacter ethanolicus X514

Site:
position = -45
score = 5.32759
sequence = TACTTTATCACGTTACAAAG

Gene: Teth514_0999: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
*
Thermoanaerobacter italicus Ab9

Site:
position = -45
score = 5.32759
sequence = TACTTTATCACGTTACAAAG

Gene: Thit_1821: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
*
Thermoanaerobacter tengcongensis MB4

Site:
position = -43
score = 5.32759
sequence = TACTTTATCACGTTACAAAG

Gene: TTE2140: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
hisG
 
Anaerocellum thermophilum DSM 6725

Gene: Athe_1479: ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17)
 
Caldicellulosiruptor saccharolyticus DSM 8903

Gene: Csac_2026: ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17)
*
Carboxydothermus hydrogenoformans Z-2901

Site:
position = -31
score = 5.65222
sequence = CACTTTAACAAAATAAAGTG

Gene: CHY_1084: ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17)
 
Moorella thermoacetica ATCC 39073

Gene: Moth_2036: ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17)
 
Thermoanaerobacter ethanolicus X514

Gene: Teth514_1000: ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17)
 
Thermoanaerobacter italicus Ab9

Gene: Thit_1820: ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17)
 
Thermoanaerobacter tengcongensis MB4

Gene: TTE2139: ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17)
ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17)
hisD
 
Anaerocellum thermophilum DSM 6725

Gene: Athe_1478: Histidinol dehydrogenase (EC 1.1.1.23)
 
Caldicellulosiruptor saccharolyticus DSM 8903

Gene: Csac_2025: Histidinol dehydrogenase (EC 1.1.1.23)
 
Carboxydothermus hydrogenoformans Z-2901

Gene: CHY_1085: Histidinol dehydrogenase (EC 1.1.1.23)
 
Moorella thermoacetica ATCC 39073

Gene: Moth_2035: Histidinol dehydrogenase (EC 1.1.1.23)
 
Thermoanaerobacter ethanolicus X514

Gene: Teth514_1001: Histidinol dehydrogenase (EC 1.1.1.23)
 
Thermoanaerobacter italicus Ab9

Gene: Thit_1819: Histidinol dehydrogenase (EC 1.1.1.23)
 
Thermoanaerobacter tengcongensis MB4

Gene: TTE2138: Histidinol dehydrogenase (EC 1.1.1.23)
Histidinol dehydrogenase (EC 1.1.1.23)
hisC
 
Anaerocellum thermophilum DSM 6725

Gene: Athe_1477: Histidinol-phosphate aminotransferase (EC 2.6.1.9)
 
Caldicellulosiruptor saccharolyticus DSM 8903

Gene: Csac_2024: Histidinol-phosphate aminotransferase (EC 2.6.1.9)
 
Carboxydothermus hydrogenoformans Z-2901

Gene: CHY_1086: Histidinol-phosphate aminotransferase (EC 2.6.1.9)
 
Moorella thermoacetica ATCC 39073
 
Thermoanaerobacter ethanolicus X514

Gene: Teth514_1002: Histidinol-phosphate aminotransferase (EC 2.6.1.9)
 
Thermoanaerobacter italicus Ab9

Gene: Thit_1818: Histidinol-phosphate aminotransferase (EC 2.6.1.9)
 
Thermoanaerobacter tengcongensis MB4

Gene: TTE2137: Histidinol-phosphate aminotransferase (EC 2.6.1.9)
Histidinol-phosphate aminotransferase (EC 2.6.1.9)
hisB
 
Anaerocellum thermophilum DSM 6725

Gene: Athe_1476: Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
 
Caldicellulosiruptor saccharolyticus DSM 8903

Gene: Csac_2023: Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
 
Carboxydothermus hydrogenoformans Z-2901

Gene: CHY_1087: Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
 
Moorella thermoacetica ATCC 39073

Gene: Moth_2034: Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
 
Thermoanaerobacter ethanolicus X514

Gene: Teth514_1003: Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
 
Thermoanaerobacter italicus Ab9

Gene: Thit_1817: Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
 
Thermoanaerobacter tengcongensis MB4

Gene: TTE2136: Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
hisH
 
Anaerocellum thermophilum DSM 6725

Gene: Athe_1475: Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
 
Caldicellulosiruptor saccharolyticus DSM 8903

Gene: Csac_2022: Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
 
Carboxydothermus hydrogenoformans Z-2901

Gene: CHY_1088: Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
 
Moorella thermoacetica ATCC 39073

Gene: Moth_2033: Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
 
Thermoanaerobacter ethanolicus X514

Gene: Teth514_1004: Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
 
Thermoanaerobacter italicus Ab9

Gene: Thit_1816: Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
 
Thermoanaerobacter tengcongensis MB4

Gene: TTE2135: Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
hisA
 
Anaerocellum thermophilum DSM 6725

Gene: Athe_1474: Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
 
Caldicellulosiruptor saccharolyticus DSM 8903

Gene: Csac_2021: Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
 
Carboxydothermus hydrogenoformans Z-2901

Gene: CHY_1089: Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
 
Moorella thermoacetica ATCC 39073

Gene: Moth_2032: Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
 
Thermoanaerobacter ethanolicus X514

Gene: Teth514_1005: Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
 
Thermoanaerobacter italicus Ab9

Gene: Thit_1815: Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
 
Thermoanaerobacter tengcongensis MB4

Gene: TTE2134: Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
hisF
 
Anaerocellum thermophilum DSM 6725

Gene: Athe_1473: Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
 
Caldicellulosiruptor saccharolyticus DSM 8903

Gene: Csac_2020: Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
 
Carboxydothermus hydrogenoformans Z-2901

Gene: CHY_1090: Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
 
Moorella thermoacetica ATCC 39073

Gene: Moth_2031: Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
 
Thermoanaerobacter ethanolicus X514

Gene: Teth514_1006: Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
 
Thermoanaerobacter italicus Ab9

Gene: Thit_1814: Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
 
Thermoanaerobacter tengcongensis MB4

Gene: TTE2133: Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
hisIE
 
Anaerocellum thermophilum DSM 6725

Gene: Athe_1472: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
 
Caldicellulosiruptor saccharolyticus DSM 8903

Gene: Csac_2019: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
 
Carboxydothermus hydrogenoformans Z-2901

Gene: CHY_1091: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
 
Moorella thermoacetica ATCC 39073

Gene: Moth_2030: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
 
Thermoanaerobacter ethanolicus X514

Gene: Teth514_1007: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
 
Thermoanaerobacter italicus Ab9

Gene: Thit_1813: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
 
Thermoanaerobacter tengcongensis MB4

Gene: TTE2132: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
hisR
 
Anaerocellum thermophilum DSM 6725

Gene: Athe_1764: Predicted histidine repressor, TrpR family
 
Caldicellulosiruptor saccharolyticus DSM 8903

Gene: Csac_2311: Predicted histidine repressor, TrpR family
*
Carboxydothermus hydrogenoformans Z-2901

Site:
position = -50
score = 5.49378
sequence = TATTTTAGTATATTAAAGTA

Gene: CHY_1082: Predicted histidine repressor, TrpR family
 
Moorella thermoacetica ATCC 39073

Gene: Moth_2038: Predicted histidine repressor, TrpR family
 
Thermoanaerobacter ethanolicus X514

Gene: Teth514_0536: Predicted histidine repressor, TrpR family
 
Thermoanaerobacter italicus Ab9

Gene: Thit_0588: Predicted histidine repressor, TrpR family
 
Thermoanaerobacter tengcongensis MB4

Gene: TTE0603: Predicted histidine repressor, TrpR family
Predicted histidine repressor, TrpR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD