Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog TyrR - Vibrionales

Properties
Regulator type: Transcription factor
Regulator family: TyrR
Regulation mode: activator (repressor)
Biological process: Aromatic amino acid metabolism
Effector: Tyrosine; Phenylalanine
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 83 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Photobacterium profundum SS9 11 6
Vibrio angustum S14 12 7
Vibrio cholerae O1 biovar eltor str. N16961 11 6
Vibrio fischeri ES114 5 4
Vibrio harveyi ATCC BAA-1116 11 6
Vibrio parahaemolyticus RIMD 2210633 12 7
Vibrio salmonicida LFI1238 5 4
Vibrio shilonii AK1 13 8
Vibrio splendidus LGP32 13 8
Vibrio vulnificus CMCP6 13 8
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
tyrR
 
Photobacterium profundum SS9

Gene: PBPRA2434: Transcriptional regulator of aromatic amino acid biosynthesis
*
Vibrio angustum S14

Site:
position = -147
score = 4.60277
sequence = GTGTAAACTCATATTAATAC

Gene: VAS14_00826: Transcriptional regulator of aromatic amino acid biosynthesis
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC1308: Transcriptional regulator of aromatic amino acid biosynthesis
*
Vibrio fischeri ES114

Site:
position = -41
score = 5.61476
sequence = GTGTAAACATATTTTGACAC

Gene: VF_A0751: Transcriptional regulator of aromatic amino acid biosynthesis
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_01919: Transcriptional regulator of aromatic amino acid biosynthesis
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP1869: Transcriptional regulator of aromatic amino acid biosynthesis
*
Vibrio salmonicida LFI1238

Site:
position = -41
score = 5.16865
sequence = CTGTAAACATATTGTGACAC

Gene: VSAL_II0864: Transcriptional regulator of aromatic amino acid biosynthesis
 
Vibrio shilonii AK1

Gene: VSAK1_01477: Transcriptional regulator of aromatic amino acid biosynthesis
*
Vibrio splendidus LGP32

Site:
position = -93
score = 4.91318
sequence = GAGTAAACATATGTTTACTC

Gene: VS_1793: Transcriptional regulator of aromatic amino acid biosynthesis
 
Vibrio vulnificus CMCP6

Gene: VV1_2270: Transcriptional regulator of aromatic amino acid biosynthesis
Transcriptional regulator of aromatic amino acid biosynthesis
 
CRON 2.
aroG
 
Photobacterium profundum SS9

Gene: PBPRB1262: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase I alpha (EC 2.5.1.54)
 
Vibrio angustum S14

Gene: VAS14_10584: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase I alpha (EC 2.5.1.54)
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio fischeri ES114

Gene: VF_A0394: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase I alpha (EC 2.5.1.54)
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_06261: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase I alpha (EC 2.5.1.54)
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -222
score = 5.43218
sequence = GTGTAAATATTATTTTACGA

Gene: VPA1185: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase I alpha (EC 2.5.1.54)
 
Vibrio salmonicida LFI1238

Gene: VSAL_II0448: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase I alpha (EC 2.5.1.54)
 
Vibrio shilonii AK1

Gene: VSAK1_14652: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase I alpha (EC 2.5.1.54)
*
Vibrio splendidus LGP32

Site:
position = -190
score = 5.13493
sequence = GTGTAAATAATGTTATACGG

Gene: VS_II0387: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase I alpha (EC 2.5.1.54)
*
Vibrio vulnificus CMCP6

Site:
position = -184
score = 5.3662
sequence = GTGTAATTATTTTTTTACAT

Gene: VV20558: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase I alpha (EC 2.5.1.54)
2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase I alpha (EC 2.5.1.54)
 
CRON 3.
COG0733
*
Photobacterium profundum SS9

Site:
position = -74
score = 5.37806
sequence = CTGTACATAATAGTTTACAG

Gene: PBPRA2512: Predicted 4-Hydroxyphenylpyruvate transporter, SNF family
*
Vibrio angustum S14

Site:
position = -243
score = 4.79539
sequence = GTGTAAACCTTAAATAACAC

Gene: VAS14_13304: Predicted 4-Hydroxyphenylpyruvate transporter, SNF family
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -50
score = 5.72507
sequence = GTGTAATTTTATTTTTACAC

Gene: VC1669: Predicted 4-Hydroxyphenylpyruvate transporter, SNF family
*
Vibrio fischeri ES114

Site:
position = -78
score = 5.16449
sequence = ATGTACAAAAATATGTACAC

Gene: VF_1605: Predicted 4-Hydroxyphenylpyruvate transporter, SNF family
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -136
score = 5.90136
sequence = GTGTACATTAATATTTACAC

Gene: VIBHAR_02692: Predicted 4-Hydroxyphenylpyruvate transporter, SNF family
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -80
score = 6.01372
sequence = GTGTATATAAATATTTACAC

Gene: VP1184: Predicted 4-Hydroxyphenylpyruvate transporter, SNF family
*
Vibrio salmonicida LFI1238

Site:
position = -52
score = 5.61488
sequence = ATGTAAAATATAATTTACAA

Gene: VSAL_I1935: Predicted 4-Hydroxyphenylpyruvate transporter, SNF family
*2
Vibrio shilonii AK1

Site:
position = -136
score = 5.23956
sequence = GTGTATAAAAATAAATACAC

Gene: VSAK1_16422: Predicted 4-Hydroxyphenylpyruvate transporter, SNF family

Site:
position = -154
score = 5.89263
sequence = GTGTAAACTAAAGATTACAC

Gene: VSAK1_01272: Predicted 4-Hydroxyphenylpyruvate transporter, SNF family
*
Vibrio splendidus LGP32

Site:
position = -87
score = 5.86814
sequence = GTGTAAATTATTATATACAC

Gene: VS_1980: Predicted 4-Hydroxyphenylpyruvate transporter, SNF family
*
Vibrio vulnificus CMCP6

Site:
position = -82
score = 5.32506
sequence = GTGTAAAAAATTTTGTACAT

Gene: VV1_2869: Predicted 4-Hydroxyphenylpyruvate transporter, SNF family
Predicted 4-Hydroxyphenylpyruvate transporter, SNF family
 
CRON 4.
aroF
*
Photobacterium profundum SS9

Site:
position = -171
score = 5.19403
sequence = GTGTAAACTTAAGTTTACGA

Gene: PBPRA3026: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Vibrio angustum S14

Site:
position = -161
score = 6.10089
sequence = CTGTAAATAATTATTTACAG

Gene: VAS14_20611: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -28
score = 6.25296
sequence = GTGTAAATAATAAATTACAG

Site:
position = -135
score = 5.39538
sequence = GTGTAATTTTTAATTTACAT

Gene: VC0695: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Vibrio fischeri ES114

Site:
position = -29
score = 5.78567
sequence = ATGGAAATAAAAGTTTACAG

Site:
position = -139
score = 5.08858
sequence = CTGTAAACTTAAATTTACGA

Gene: VF_0553: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -29
score = 5.99042
sequence = GTGTAAACATAAATATACAG

Site:
position = -139
score = 6.41548
sequence = ATGTAAATTAAAATTTACAC

Gene: VIBHAR_00992: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -29
score = 6.04794
sequence = GTGTAAAAATAAATATACAG

Site:
position = -139
score = 6.52573
sequence = GTGTAAATTAATATTTACAG

Gene: VP0546: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Vibrio salmonicida LFI1238

Site:
position = -137
score = 5.08858
sequence = TTGTAAATTTAAGTTTACGA

Site:
position = -28
score = 5.2079
sequence = ATGGACATAAAAGTTTACAG

Gene: VSAL_I0653: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Vibrio shilonii AK1

Site:
position = -28
score = 6.37222
sequence = GTGTAAAATAATATTTACAG

Site:
position = -141
score = 5.96273
sequence = GTGTAAAATTATATTTACAT

Gene: VSAK1_14082: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Vibrio splendidus LGP32

Site:
position = -135
score = 6.2217
sequence = GTGTAAACTTAAATTTACAC

Site:
position = -28
score = 6.04794
sequence = GTGTAAAAATAAATATACAG

Gene: VS_0547: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Vibrio vulnificus CMCP6

Site:
position = -30
score = 5.93959
sequence = GTGTAAAAAATAATATACAG

Site:
position = -137
score = 5.61672
sequence = GTGTAATTTATTTTTTACAC

Gene: VV1_0495: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
tyrA
 
Photobacterium profundum SS9

Gene: PBPRA3025: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
Vibrio angustum S14

Gene: VAS14_20616: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC0696: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
Vibrio fischeri ES114

Gene: VF_0554: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_00993: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP0547: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
Vibrio salmonicida LFI1238

Gene: VSAL_I0654: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
Vibrio shilonii AK1

Gene: VSAK1_14087: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
Vibrio splendidus LGP32

Gene: VS_0548: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
Vibrio vulnificus CMCP6

Gene: VV1_0494: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
CRON 5.
hpd
 
Photobacterium profundum SS9

Gene: PBPRB1180: 4-hydroxyphenylpyruvate dioxygenase (EC 1.13.11.27)
 
Vibrio angustum S14

Gene: VAS14_13434: 4-hydroxyphenylpyruvate dioxygenase (EC 1.13.11.27)
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -256
score = 4.77228
sequence = AAGTAACAATATTGTTACAT

Site:
position = -86
score = 4.72045
sequence = ATGTAATAAAATTGTTACCT

Gene: VC1344: 4-hydroxyphenylpyruvate dioxygenase (EC 1.13.11.27)
 
Vibrio fischeri ES114
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -147
score = 5.1829
sequence = CTGTAACATAAATTTTACAA

Gene: VIBHAR_02177: 4-hydroxyphenylpyruvate dioxygenase (EC 1.13.11.27)
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -154
score = 5.56288
sequence = GTGTAACATTAATTTTACAT

Gene: VP1349: 4-hydroxyphenylpyruvate dioxygenase (EC 1.13.11.27)
 
Vibrio salmonicida LFI1238
*
Vibrio shilonii AK1

Site:
position = -169
score = 4.77477
sequence = ATGTAGCAAAAATGTTACAA

Gene: VSAK1_19029: 4-hydroxyphenylpyruvate dioxygenase (EC 1.13.11.27)
*
Vibrio splendidus LGP32

Site:
position = -146
score = 5.39104
sequence = GTGTAACAAATATTTTACAA

Gene: VS_II1521: 4-hydroxyphenylpyruvate dioxygenase (EC 1.13.11.27)
*
Vibrio vulnificus CMCP6

Site:
position = -252
score = 4.59528
sequence = GGTTAACATAAAATTTACAT

Site:
position = -137
score = 4.67713
sequence = GTGTAACAAATGCTTTACAT

Gene: VV1_2768: 4-hydroxyphenylpyruvate dioxygenase (EC 1.13.11.27)
4-hydroxyphenylpyruvate dioxygenase (EC 1.13.11.27)
hmgA
*
Photobacterium profundum SS9

Site:
position = -321
score = 5.67525
sequence = GTGTAACATAAATTTTACAT

Site:
position = -164
score = 4.30387
sequence = ATGTAAAATATTCAACACAC

Gene: PBPRB1165: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
*
Vibrio angustum S14

Site:
position = -109
score = 4.19535
sequence = TTGTAAACAAGAATGAACAT

Gene: VAS14_11214: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC1345: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
 
Vibrio fischeri ES114
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_02178: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP1350: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1

Gene: VSAK1_19034: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
 
Vibrio splendidus LGP32

Gene: VS_II1520: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
 
Vibrio vulnificus CMCP6

Gene: VV1_2767: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
hmgC
 
Photobacterium profundum SS9

Gene: PBPRB1166: Fumarylacetoacetase (EC 3.7.1.2)
 
Vibrio angustum S14

Gene: VAS14_11209: Fumarylacetoacetase (EC 3.7.1.2)
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC1346: Fumarylacetoacetase (EC 3.7.1.2)
 
Vibrio fischeri ES114
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_02179: Fumarylacetoacetase (EC 3.7.1.2)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP1351: Fumarylacetoacetase (EC 3.7.1.2)
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1

Gene: VSAK1_19039: Fumarylacetoacetase (EC 3.7.1.2)
 
Vibrio splendidus LGP32

Gene: VS_II1519: Fumarylacetoacetase (EC 3.7.1.2)
 
Vibrio vulnificus CMCP6

Gene: VV1_2766: Fumarylacetoacetase (EC 3.7.1.2)
Fumarylacetoacetase (EC 3.7.1.2)
hmgB
 
Photobacterium profundum SS9

Gene: PBPRB1167: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Vibrio angustum S14

Gene: VAS14_11204: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC1347: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Vibrio fischeri ES114
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_02180: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP1352: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1

Gene: VSAK1_19044: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Vibrio splendidus LGP32

Gene: VS_II1518: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Vibrio vulnificus CMCP6

Gene: VV1_2765: Maleylacetoacetate isomerase (EC 5.2.1.2)
Maleylacetoacetate isomerase (EC 5.2.1.2)
acsA
 
Photobacterium profundum SS9

Gene: PBPRB1168: Acetoacetyl-CoA synthetase (EC 6.2.1.16)
 
Vibrio angustum S14

Gene: VAS14_11199: Acetoacetyl-CoA synthetase (EC 6.2.1.16)
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -144
score = 5.36978
sequence = ATGTAACAATAATTTTACAA

Gene: VCA0829: Acetoacetyl-CoA synthetase (EC 6.2.1.16)
 
Vibrio fischeri ES114
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -130
score = 4.87876
sequence = GTGTAACATTTTCTTTACAT

Gene: VIBHAR_05420: Acetoacetyl-CoA synthetase (EC 6.2.1.16)
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -130
score = 5.12347
sequence = ATGTAACATATTGTTTACAT

Gene: VPA0575: Acetoacetyl-CoA synthetase (EC 6.2.1.16)
 
Vibrio salmonicida LFI1238
*
Vibrio shilonii AK1

Site:
position = -136
score = 5.46411
sequence = GTGTAACAATTTATTTACAT

Gene: VSAK1_21594: Acetoacetyl-CoA synthetase (EC 6.2.1.16)
*
Vibrio splendidus LGP32

Site:
position = -112
score = 5.60226
sequence = GTGTAACATTTTATTTACAC

Gene: VS_II1510: Acetoacetyl-CoA synthetase (EC 6.2.1.16)
*
Vibrio vulnificus CMCP6

Site:
position = -135
score = 4.70291
sequence = GTGTAACATTTTCTTTACAA

Gene: VV2_0456: Acetoacetyl-CoA synthetase (EC 6.2.1.16)
Acetoacetyl-CoA synthetase (EC 6.2.1.16)
 
CRON 6.
phhA
*
Photobacterium profundum SS9

Site:
position = -243
score = 5.7237
sequence = ATGTAAAATTTATGTTACAC

Gene: PBPRB1164: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
*
Vibrio angustum S14

Site:
position = -182
score = 3.82606
sequence = ATGTTCATTCTTGTTTACAA

Gene: VAS14_11219: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -34
score = 5.44106
sequence = TTGTAAAATTATTGTTACAT

Gene: VCA0828: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
 
Vibrio fischeri ES114
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -111
score = 6.11164
sequence = ATGTAAAGAAAATGTTACAC

Gene: VIBHAR_05421: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -111
score = 5.6404
sequence = ATGTAAACAATATGTTACAT

Gene: VPA0576: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
 
Vibrio salmonicida LFI1238
*
Vibrio shilonii AK1

Site:
position = -109
score = 6.2567
sequence = ATGTAAATAAATTGTTACAC

Gene: VSAK1_21599: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
*
Vibrio splendidus LGP32

Site:
position = -107
score = 6.45229
sequence = GTGTAAATAAAATGTTACAC

Gene: VS_II1509: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
*
Vibrio vulnificus CMCP6

Site:
position = -111
score = 5.92476
sequence = TTGTAAAGAAAATGTTACAC

Gene: VV20455: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
Phenylalanine-4-hydroxylase (EC 1.14.16.1)
phhB
 
Photobacterium profundum SS9

Gene: PBPRB1163: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
Vibrio angustum S14

Gene: VAS14_11224: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VCA0827: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
Vibrio fischeri ES114
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_05422: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0577: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1

Gene: VSAK1_21604: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
Vibrio splendidus LGP32

Gene: VS_II1508: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
Vibrio vulnificus CMCP6

Gene: VV20454: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
CRON 7.
COG1284
*
Photobacterium profundum SS9

Site:
position = -106
score = 5.6516
sequence = ATGTAAAAAAATCATTACAG

Gene: PBPRA0794: Conserved hypothetical protein
*
Vibrio angustum S14

Site:
position = -106
score = 6.02388
sequence = GTGTAAAAAATATATTACAG

Gene: VAS14_16576: Conserved hypothetical protein
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC0940: Conserved hypothetical protein
 
Vibrio fischeri ES114

Gene: VF_0694: Conserved hypothetical protein
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_01207: Conserved hypothetical protein
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP0714: Conserved hypothetical protein
 
Vibrio salmonicida LFI1238

Gene: VSAL_I0865: Conserved hypothetical protein
*
Vibrio shilonii AK1

Site:
position = -111
score = 5.08524
sequence = GTGTAAAATTTGAATTACAT

Gene: VSAK1_10508: Conserved hypothetical protein
 
Vibrio splendidus LGP32

Gene: VS_2374: Conserved hypothetical protein
*
Vibrio vulnificus CMCP6

Site:
position = -112
score = 4.70442
sequence = CTGTAAAACAACAATTACAT

Gene: VV1_0287: Conserved hypothetical protein
Conserved hypothetical protein
 
CRON 8.
tyrP
*
Photobacterium profundum SS9

Site:
position = -224
score = 5.95394
sequence = ATGTAAATATAAGTTTACAT

Site:
position = -37
score = 4.5406
sequence = GTGTAAAGTTTTATGAACAT

Gene: PBPRA2465: tyrosine-specific transport protein
*
Vibrio angustum S14

Site:
position = -312
score = 5.5872
sequence = ACGTAAATATAAATTTACAT

Site:
position = -125
score = 5.92656
sequence = ATGTAACTAAAAGTTTACAC

Gene: VAS14_18444: tyrosine-specific transport protein
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -20
score = 5.04535
sequence = ATGTATAAAAGAGTTTACAC

Site:
position = -168
score = 6.07461
sequence = GTGTAAATTATTAATTACAG

Gene: VCA0772: tyrosine-specific transport protein
*
Vibrio fischeri ES114

Site:
position = -132
score = 6.0843
sequence = GTGTAAACATATAATTACAG

Gene: VF_1197: tyrosine-specific transport protein
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -287
score = 5.49443
sequence = GTGTATAAAATAGTTTACAC

Site:
position = -139
score = 5.20094
sequence = CTGTAAAGATAAATATACAA

Gene: VIBHAR_02530: tyrosine-specific transport protein
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -167
score = 6.12589
sequence = GTGTAAATATAATTTTACGG

Site:
position = -19
score = 5.38782
sequence = ATGTAAAGATAAATATACAA

Gene: VP1426: tyrosine-specific transport protein
*
Vibrio salmonicida LFI1238

Site:
position = -117
score = 5.29795
sequence = TTGTAATAATAAGTTTACAC

Gene: VSAL_I1774: tyrosine-specific transport protein
*
Vibrio shilonii AK1

Site:
position = -144
score = 4.62006
sequence = AGATAAATTTATGTTTACAT

Site:
position = -165
score = 5.05224
sequence = CTGTAAACACACTTTTACAC

Gene: VSAK1_15307: tyrosine-specific transport protein
*
Vibrio splendidus LGP32

Site:
position = -163
score = 5.08647
sequence = CTGTACATATTAATATACAG

Site:
position = -144
score = 4.50959
sequence = GTGGATATTTTTAATTACAT

Gene: VS_II0802: tyrosine-specific transport protein
*
Vibrio vulnificus CMCP6

Site:
position = -169
score = 4.92431
sequence = GTGTATTATTAAGTTTACAC

Site:
position = -21
score = 4.81915
sequence = CCGTAAATATAAGAATACAC

Gene: VV1_2293: tyrosine-specific transport protein
tyrosine-specific transport protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD