Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog TyrR2 - Alteromonadales

Properties
Regulator type: Transcription factor
Regulator family: TyrR
Regulation mode: activator (repressor)
Biological process: Tyrosine degradation; Aromatic amino acid metabolism
Effector: Tyrosine; Phenylalanine
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Alteromonas macleodii 'Deep ecotype'
Alteromonadales bacterium TW-7
Colwellia psychrerythraea 34H
Glaciecola sp. HTCC2999
Idiomarina loihiensis L2TR 8 2
Idiomarina baltica OS145 8 3
Pseudoalteromonas tunicata D2
Pseudoalteromonas haloplanktis TAC125
Pseudoalteromonas atlantica T6c
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
hpd
 
Alteromonas macleodii 'Deep ecotype'
 
Alteromonadales bacterium TW-7
 
Colwellia psychrerythraea 34H
 
Glaciecola sp. HTCC2999
*
Idiomarina loihiensis L2TR

Site:
position = -188
score = 5.45999
sequence = TTGTAACAAAAGCTTTACAA

Site:
position = -128
score = 4.91131
sequence = CTGTACATTAAACTTTACGT

Gene: IL0722: 4-hydroxyphenylpyruvate dioxygenase (EC 1.13.11.27)
*
Idiomarina baltica OS145

Site:
position = -146
score = 5.25626
sequence = TTGTAAATAAAAGGTTACAA

Site:
position = -217
score = 5.17768
sequence = GTGTACAATTAAGTTTACGA

Gene: OS145_07137: 4-hydroxyphenylpyruvate dioxygenase (EC 1.13.11.27)
 
Pseudoalteromonas tunicata D2
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas atlantica T6c

Gene: Patl_2997: 4-hydroxyphenylpyruvate dioxygenase (EC 1.13.11.27)
4-hydroxyphenylpyruvate dioxygenase (EC 1.13.11.27)
hmgA
 
Alteromonas macleodii 'Deep ecotype'
 
Alteromonadales bacterium TW-7

Gene: ATW7_02742: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
 
Colwellia psychrerythraea 34H
 
Glaciecola sp. HTCC2999
 
Idiomarina loihiensis L2TR

Gene: IL0721: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
 
Idiomarina baltica OS145

Gene: OS145_07132: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
 
Pseudoalteromonas tunicata D2

Gene: PTD2_03416: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAb0338: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
 
Pseudoalteromonas atlantica T6c
Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
hmgC
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_02827: Fumarylacetoacetase (EC 3.7.1.2)
 
Alteromonadales bacterium TW-7
 
Colwellia psychrerythraea 34H

Gene: CPS_3763: Fumarylacetoacetase (EC 3.7.1.2)
 
Glaciecola sp. HTCC2999
 
Idiomarina loihiensis L2TR

Gene: IL0720: Fumarylacetoacetase (EC 3.7.1.2)
 
Idiomarina baltica OS145

Gene: OS145_07127: Fumarylacetoacetase (EC 3.7.1.2)
 
Pseudoalteromonas tunicata D2
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas atlantica T6c
Fumarylacetoacetase (EC 3.7.1.2)
hmgB
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_02826: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Alteromonadales bacterium TW-7

Gene: ATW7_02737: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Colwellia psychrerythraea 34H

Gene: CPS_3762: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Glaciecola sp. HTCC2999
 
Idiomarina loihiensis L2TR

Gene: IL0719: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Idiomarina baltica OS145

Gene: OS145_07122: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Pseudoalteromonas tunicata D2

Gene: PTD2_03421: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAb0337: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Pseudoalteromonas atlantica T6c

Gene: Patl_1448: Maleylacetoacetate isomerase (EC 5.2.1.2)
Maleylacetoacetate isomerase (EC 5.2.1.2)
 
CRON 2.
mdeA
 
Alteromonas macleodii 'Deep ecotype'
 
Alteromonadales bacterium TW-7

Gene: ATW7_09361: Methionine gamma-lyase (EC 4.4.1.11)
 
Colwellia psychrerythraea 34H

Gene: CPS_1705: Methionine gamma-lyase (EC 4.4.1.11)
 
Glaciecola sp. HTCC2999
*
Idiomarina loihiensis L2TR

Site:
position = -119
score = 5.21703
sequence = GTGGAAAACTAGCGTTACAG

Gene: IL0726: Methionine gamma-lyase (EC 4.4.1.11)
*
Idiomarina baltica OS145

Site:
position = -140
score = 5.16879
sequence = GTGGAAAAATAGCGTTACAG

Gene: OS145_07157: Methionine gamma-lyase (EC 4.4.1.11)
 
Pseudoalteromonas tunicata D2

Gene: PTD2_15972: Methionine gamma-lyase (EC 4.4.1.11)
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAa2044: Methionine gamma-lyase (EC 4.4.1.11)
 
Pseudoalteromonas atlantica T6c
Methionine gamma-lyase (EC 4.4.1.11)
phhA
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_02830: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
 
Alteromonadales bacterium TW-7

Gene: ATW7_09356: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
 
Colwellia psychrerythraea 34H

Gene: CPS_3766: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
 
Glaciecola sp. HTCC2999
 
Idiomarina loihiensis L2TR

Gene: IL0725: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
 
Idiomarina baltica OS145

Gene: OS145_07152: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
 
Pseudoalteromonas tunicata D2

Gene: PTD2_15977: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAa2043: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
 
Pseudoalteromonas atlantica T6c

Gene: Patl_2999: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
Phenylalanine-4-hydroxylase (EC 1.14.16.1)
phhB
 
Alteromonas macleodii 'Deep ecotype'
 
Alteromonadales bacterium TW-7

Gene: ATW7_09351: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
Colwellia psychrerythraea 34H

Gene: CPS_3765: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
Glaciecola sp. HTCC2999
 
Idiomarina loihiensis L2TR

Gene: IL0724: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
Idiomarina baltica OS145

Gene: OS145_07147: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
Pseudoalteromonas tunicata D2

Gene: PTD2_15982: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAa2042: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
Pseudoalteromonas atlantica T6c
Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
tyrR2
 
Alteromonas macleodii 'Deep ecotype'
 
Alteromonadales bacterium TW-7
 
Colwellia psychrerythraea 34H
 
Glaciecola sp. HTCC2999
 
Idiomarina loihiensis L2TR

Gene: IL0723: Tyrosine and phenylalanine degradation transcriptional activator, TyrR family
*
Idiomarina baltica OS145

Site:
position = -43
score = 5.16114
sequence = CTGTACGATATACTTTACAG

Gene: OS145_07142: Tyrosine and phenylalanine degradation transcriptional activator, TyrR family
 
Pseudoalteromonas tunicata D2
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas atlantica T6c
Tyrosine and phenylalanine degradation transcriptional activator, TyrR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD