Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog GcvR - Pseudomonadales

Properties
Regulator type: Transcription factor
Regulator family: TyrR
Regulation mode: activator
Biological process: Glycine metabolism
Effector: Glycine
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 20 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Azotobacter vinelandii AvOP 3 1
Pseudomonas aeruginosa PAO1 5 1
Pseudomonas entomophila L48 4 1
Pseudomonas fluorescens Pf-5 4 1
Pseudomonas mendocina ymp 4 1
Pseudomonas putida KT2440 4 1
Pseudomonas stutzeri A1501
Pseudomonas syringae pv. tomato str. DC3000 3 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
gcvH
 
Azotobacter vinelandii AvOP
*2
Pseudomonas aeruginosa PAO1

Site:
position = -264
score = 4.3521
sequence = CTGTAACGCTTCGGTTACGA

Site:
position = -163
score = 5.44855
sequence = CTGTAACGAAAGCGTTCCAT

Site:
position = -244
score = 5.61985
sequence = GTGGAACGAATTCGTTCCGA

Gene: PA2446: Glycine cleavage system H protein

Gene: PA5214: Glycine cleavage system H protein
*
Pseudomonas entomophila L48

Site:
position = -265
score = 5.35063
sequence = CCGTATCGAATTCAATCCAC

Site:
position = -246
score = 4.63074
sequence = CCGTAATCAAATCATTCCAC

Site:
position = -165
score = 5.67398
sequence = GTGTATCGATTTCGTTCCAT

Gene: PSEEN4435: Glycine cleavage system H protein
*
Pseudomonas fluorescens Pf-5

Site:
position = -280
score = 4.96596
sequence = CTGTACTGAAAGCGCTACAG

Site:
position = -261
score = 5.73571
sequence = GTGGAACGATTTCGCTACAA

Site:
position = -180
score = 5.5213
sequence = CTGTAGCGTTTTCGCTACGG

Gene: PFL_4640: Glycine cleavage system H protein
*
Pseudomonas mendocina ymp

Site:
position = -258
score = 5.78852
sequence = CTGTATCGATATCGATCCAC

Site:
position = -239
score = 4.72747
sequence = CCGTAACGATTTAGCAACAA

Site:
position = -158
score = 5.7446
sequence = TCGTATCGATATCGTTCCAG

Gene: Pmen_1346: Glycine cleavage system H protein
*
Pseudomonas putida KT2440

Site:
position = -166
score = 5.66033
sequence = CTGTAACGATATCATTCCAC

Site:
position = -266
score = 5.16954
sequence = ATGTATCGTTTTCGCTACGT

Site:
position = -247
score = 5.36584
sequence = TCGTAGCGAAAACGATACAC

Gene: PP0989: Glycine cleavage system H protein
 
Pseudomonas stutzeri A1501

Gene: PST_4063: Glycine cleavage system H protein
*
Pseudomonas syringae pv. tomato str. DC3000

Site:
position = -156
score = 5.81584
sequence = CCGTAGCGATTTCGCTACAG

Site:
position = -256
score = 5.37022
sequence = GCGAAACGAAATCGTTCCAC

Site:
position = -237
score = 5.42847
sequence = CCGTAACGATTACATTACAG

Gene: PSPTO1277: Glycine cleavage system H protein
Glycine cleavage system H protein
gcvP
*
Azotobacter vinelandii AvOP

Site:
position = -180
score = 5.71961
sequence = CCGTAACGATTTCGTTCCGA

Site:
position = -250
score = 5.25009
sequence = TCGTAACGATTTCGAAACAA

Gene: Avin_26020: Glycine dehydrogenase [decarboxylating] (glycine cleavage system P protein) (EC 1.4.4.2)
 2
Pseudomonas aeruginosa PAO1

Gene: PA2445: Glycine dehydrogenase [decarboxylating] (glycine cleavage system P protein) (EC 1.4.4.2)

Gene: PA5213: Glycine dehydrogenase [decarboxylating] (glycine cleavage system P protein) (EC 1.4.4.2)
 
Pseudomonas entomophila L48

Gene: PSEEN4436: Glycine dehydrogenase [decarboxylating] (glycine cleavage system P protein) (EC 1.4.4.2)
 
Pseudomonas fluorescens Pf-5

Gene: PFL_4641: Glycine dehydrogenase [decarboxylating] (glycine cleavage system P protein) (EC 1.4.4.2)
 
Pseudomonas mendocina ymp

Gene: Pmen_1345: Glycine dehydrogenase [decarboxylating] (glycine cleavage system P protein) (EC 1.4.4.2)
 
Pseudomonas putida KT2440

Gene: PP0988: Glycine dehydrogenase [decarboxylating] (glycine cleavage system P protein) (EC 1.4.4.2)
 
Pseudomonas stutzeri A1501

Gene: PST_4062: Glycine dehydrogenase [decarboxylating] (glycine cleavage system P protein) (EC 1.4.4.2)
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO1276: Glycine dehydrogenase [decarboxylating] (glycine cleavage system P protein) (EC 1.4.4.2)
Glycine dehydrogenase [decarboxylating] (glycine cleavage system P protein) (EC 1.4.4.2)
glyA
 
Azotobacter vinelandii AvOP
 
Pseudomonas aeruginosa PAO1

Gene: PA2444: Serine hydroxymethyltransferase (EC 2.1.2.1)
 
Pseudomonas entomophila L48
 
Pseudomonas fluorescens Pf-5
 
Pseudomonas mendocina ymp

Gene: Pmen_1344: Serine hydroxymethyltransferase (EC 2.1.2.1)
 
Pseudomonas putida KT2440
 
Pseudomonas stutzeri A1501
 
Pseudomonas syringae pv. tomato str. DC3000
Serine hydroxymethyltransferase (EC 2.1.2.1)
sdaA
 
Azotobacter vinelandii AvOP

Gene: Avin_26040: L-serine dehydratase (EC 4.3.1.17)
 
Pseudomonas aeruginosa PAO1

Gene: PA2443: L-serine dehydratase (EC 4.3.1.17)
 
Pseudomonas entomophila L48

Gene: PSEEN4437: L-serine dehydratase (EC 4.3.1.17)
 
Pseudomonas fluorescens Pf-5

Gene: PFL_4642: L-serine dehydratase (EC 4.3.1.17)
 
Pseudomonas mendocina ymp
 
Pseudomonas putida KT2440

Gene: PP0987: L-serine dehydratase (EC 4.3.1.17)
 
Pseudomonas stutzeri A1501

Gene: PST_3559: L-serine dehydratase (EC 4.3.1.17)
 
Pseudomonas syringae pv. tomato str. DC3000
L-serine dehydratase (EC 4.3.1.17)
gcvT
 
Azotobacter vinelandii AvOP

Gene: Avin_26050: Aminomethyltransferase (glycine cleavage system T protein) (EC 2.1.2.10)
 2
Pseudomonas aeruginosa PAO1

Gene: PA5215: Aminomethyltransferase (glycine cleavage system T protein) (EC 2.1.2.10)

Gene: PA2442: Aminomethyltransferase (glycine cleavage system T protein) (EC 2.1.2.10)
 
Pseudomonas entomophila L48

Gene: PSEEN4438: Aminomethyltransferase (glycine cleavage system T protein) (EC 2.1.2.10)
 
Pseudomonas fluorescens Pf-5

Gene: PFL_4643: Aminomethyltransferase (glycine cleavage system T protein) (EC 2.1.2.10)
 
Pseudomonas mendocina ymp

Gene: Pmen_1343: Aminomethyltransferase (glycine cleavage system T protein) (EC 2.1.2.10)
 
Pseudomonas putida KT2440

Gene: PP0986: Aminomethyltransferase (glycine cleavage system T protein) (EC 2.1.2.10)
 
Pseudomonas stutzeri A1501

Gene: PST_4064: Aminomethyltransferase (glycine cleavage system T protein) (EC 2.1.2.10)
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO1275: Aminomethyltransferase (glycine cleavage system T protein) (EC 2.1.2.10)
Aminomethyltransferase (glycine cleavage system T protein) (EC 2.1.2.10)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD