Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PsrA - Shewanellaceae

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Fatty acid degradation
Effector: Oleate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 295 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Shewanella oneidensis MR-1 25 16
Shewanella putrefaciens CN-32 26 17
Shewanella sp W3-18-1 26 17
Shewanella sp ANA-3 25 16
Shewanella sp MR-4 25 16
Shewanella sp MR-7 25 16
Shewanella baltica OS155 26 17
Shewanella denitrificans OS217 23 15
Shewanella frigidimarina NCIMB 400 25 16
Shewanella amazonensis SB2B 23 15
Shewanella loihica PV-4 25 17
Shewanella pealeana ATCC 700345 24 17
Shewanella halifaxensis HAW-EB4 24 17
Shewanella piezotolerans WP3 24 17
Shewanella sediminis HAW-EB3 27 18
Shewanella woodyi ATCC 51908 24 17
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
fadD2
*
Shewanella oneidensis MR-1

Site:
position = -63
score = 5.62202
sequence = ATCTAAACACCCGTTTGATT

Gene: SO_3664: long-chain-fatty-acid--CoA ligase
*
Shewanella putrefaciens CN-32

Site:
position = -66
score = 5.50475
sequence = ATCTAAACATATGTTTGATT

Gene: Sputcn32_0970: long-chain-fatty-acid--CoA ligase
*
Shewanella sp W3-18-1

Site:
position = -65
score = 5.50475
sequence = ATCTAAACATATGTTTGATT

Gene: Sputw3181_3197: long-chain-fatty-acid--CoA ligase
*
Shewanella sp ANA-3

Site:
position = -62
score = 5.55802
sequence = ATCTAAACACTCGTTTGATT

Gene: Shewana3_3231: long-chain-fatty-acid--CoA ligase
*
Shewanella sp MR-4

Site:
position = -62
score = 5.55802
sequence = ATCTAAACACTCGTTTGATT

Gene: Shewmr4_0883: long-chain-fatty-acid--CoA ligase
*
Shewanella sp MR-7

Site:
position = -62
score = 5.55802
sequence = ATCTAAACACTCGTTTGATT

Gene: Shewmr7_3139: long-chain-fatty-acid--CoA ligase
*
Shewanella baltica OS155

Site:
position = -66
score = 5.42396
sequence = ATCTAAACACCTGTTTAACT

Gene: Sbal_0956: long-chain-fatty-acid--CoA ligase
 
Shewanella denitrificans OS217

Gene: Sden_2934: long-chain-fatty-acid--CoA ligase
*
Shewanella frigidimarina NCIMB 400

Site:
position = -55
score = 5.5014
sequence = ATCTAAACGGACGTTTGATT

Gene: Sfri_3097: long-chain-fatty-acid--CoA ligase
 
Shewanella amazonensis SB2B

Gene: Sama_2897: long-chain-fatty-acid--CoA ligase
*
Shewanella loihica PV-4

Site:
position = -130
score = 5.26511
sequence = TGTTAAACGATTGTTTTATT

Site:
position = -70
score = 5.07459
sequence = GTCTAAACACCTGTTTGATT

Gene: Shew_3084: long-chain-fatty-acid--CoA ligase
*
Shewanella pealeana ATCC 700345

Site:
position = -70
score = 5.55802
sequence = ATCTAAACGCTTGTTTGATT

Gene: Spea_3322: long-chain-fatty-acid--CoA ligase
*
Shewanella halifaxensis HAW-EB4

Site:
position = -62
score = 4.81525
sequence = gTcTAAACAGCTGTTTgAcT

Gene: Shal_3395: long-chain-fatty-acid--CoA ligase
*
Shewanella piezotolerans WP3

Site:
position = -66
score = 5.66963
sequence = ATCTAAACACCTGTTTGATT

Gene: swp_3965: long-chain-fatty-acid--CoA ligase
*
Shewanella sediminis HAW-EB3

Site:
position = -83
score = 5.62202
sequence = ATCTAAACGCCTGTTTGATT

Gene: Ssed_3695: long-chain-fatty-acid--CoA ligase
*
Shewanella woodyi ATCC 51908

Site:
position = -95
score = 5.66963
sequence = ATCTAAACACCTGTTTGATT

Gene: Swoo_3995: long-chain-fatty-acid--CoA ligase
long-chain-fatty-acid--CoA ligase
 
CRON 2.
fadD3
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
*
Shewanella sediminis HAW-EB3

Site:
position = -180
score = 5.4703
sequence = ATTAAAACGATCGTTTGCTT

Gene: Ssed_1667: long-chain-fatty-acid--CoA ligase
 
Shewanella woodyi ATCC 51908

Gene: Swoo_2941: long-chain-fatty-acid--CoA ligase
long-chain-fatty-acid--CoA ligase
 
CRON 3.
fadD1
*
Shewanella oneidensis MR-1

Site:
position = -136
score = 5.48194
sequence = ATTAAAACGCCCGTATGATT

Gene: SO_2581: long-chain-fatty-acid--CoA ligase
*
Shewanella putrefaciens CN-32

Site:
position = -135
score = 5.41794
sequence = ATTAAAACGCTCGTATGATT

Gene: Sputcn32_1761: long-chain-fatty-acid--CoA ligase
*
Shewanella sp W3-18-1

Site:
position = -135
score = 5.41794
sequence = ATTAAAACGCTCGTATGATT

Gene: Sputw3181_2264: long-chain-fatty-acid--CoA ligase
*
Shewanella sp ANA-3

Site:
position = -136
score = 5.48194
sequence = ATTAAAACGCCCGTATGATT

Gene: Shewana3_2386: long-chain-fatty-acid--CoA ligase
*
Shewanella sp MR-4

Site:
position = -136
score = 5.48194
sequence = ATTAAAACGCCCGTATGATT

Gene: Shewmr4_2177: long-chain-fatty-acid--CoA ligase
*
Shewanella sp MR-7

Site:
position = -136
score = 5.48194
sequence = ATTAAAACGCCCGTATGATT

Gene: Shewmr7_2254: long-chain-fatty-acid--CoA ligase
*
Shewanella baltica OS155

Site:
position = -137
score = 5.41794
sequence = ATTAAAACGCTCGTATGATT

Gene: Sbal_1864: long-chain-fatty-acid--CoA ligase
*
Shewanella denitrificans OS217

Site:
position = -169
score = 5.57327
sequence = ATTTAAACGGCCGTATGATT

Gene: Sden_1625: long-chain-fatty-acid--CoA ligase
*
Shewanella frigidimarina NCIMB 400

Site:
position = -145
score = 5.23496
sequence = ATTAAAACACTTGTATGACT

Gene: Sfri_1733: long-chain-fatty-acid--CoA ligase
*
Shewanella amazonensis SB2B

Site:
position = -120
score = 5.55443
sequence = ATTTAAACGCCCGTATGATT

Gene: Sama_1934: long-chain-fatty-acid--CoA ligase
*
Shewanella loihica PV-4

Site:
position = -130
score = 5.48194
sequence = ATTAAAACGCCCGTATGATT

Gene: Shew_2188: long-chain-fatty-acid--CoA ligase
*
Shewanella pealeana ATCC 700345

Site:
position = -137
score = 5.50927
sequence = ATTTAAACGACCGTATGATT

Gene: Spea_2448: long-chain-fatty-acid--CoA ligase
*
Shewanella halifaxensis HAW-EB4

Site:
position = -136
score = 5.49043
sequence = ATTTAAACGCTCGTATGATT

Gene: Shal_1832: long-chain-fatty-acid--CoA ligase
*
Shewanella piezotolerans WP3

Site:
position = -134
score = 5.53803
sequence = ATTTAAACGCTTGTATGATT

Gene: swp_2289: long-chain-fatty-acid--CoA ligase
*
Shewanella sediminis HAW-EB3

Site:
position = -132
score = 5.67152
sequence = ATTAAAACGCCTGTATGAAT

Gene: Ssed_2523: long-chain-fatty-acid--CoA ligase
*
Shewanella woodyi ATCC 51908

Site:
position = -134
score = 5.67152
sequence = ATTAAAACGCCTGTATGAAT

Gene: Swoo_2110: long-chain-fatty-acid--CoA ligase
long-chain-fatty-acid--CoA ligase
 
CRON 4.
psrA
*
Shewanella oneidensis MR-1

Site:
position = 40
score = 5.8724
sequence = ATTTAAACGAGTGTTTTAAA

Gene: SO_2493: fatty acid degradation transcriptional regulator, TetR family
*
Shewanella putrefaciens CN-32

Site:
position = -38
score = 5.8724
sequence = ATTTAAACGAGTGTTTTAAA

Gene: Sputcn32_1862: fatty acid degradation transcriptional regulator, TetR family
*
Shewanella sp W3-18-1

Site:
position = -38
score = 5.8724
sequence = ATTTAAACGAGTGTTTTAAA

Gene: Sputw3181_2147: fatty acid degradation transcriptional regulator, TetR family
*
Shewanella sp ANA-3

Site:
position = -38
score = 5.8724
sequence = ATTTAAACGAGTGTTTTAAA

Gene: Shewana3_2155: fatty acid degradation transcriptional regulator, TetR family
*
Shewanella sp MR-4

Site:
position = -38
score = 5.8724
sequence = ATTTAAACGAGTGTTTTAAA

Gene: Shewmr4_2050: fatty acid degradation transcriptional regulator, TetR family
*
Shewanella sp MR-7

Site:
position = -38
score = 5.8724
sequence = ATTTAAACGAGTGTTTTAAA

Gene: Shewmr7_1925: fatty acid degradation transcriptional regulator, TetR family
*
Shewanella baltica OS155

Site:
position = -38
score = 5.8724
sequence = ATTTAAACGAGTGTTTTAAA

Gene: Sbal_2245: fatty acid degradation transcriptional regulator, TetR family
*
Shewanella denitrificans OS217

Site:
position = -24
score = 5.984
sequence = ATTTAAACAGGTGTTTTAAA

Gene: Sden_2116: fatty acid degradation transcriptional regulator, TetR family
*
Shewanella frigidimarina NCIMB 400

Site:
position = -36
score = 6.30369
sequence = ATTTAAACAGGTGTTTAAAT

Gene: Sfri_1888: fatty acid degradation transcriptional regulator, TetR family
*
Shewanella amazonensis SB2B

Site:
position = 7
score = 5.8724
sequence = ATTTAAACGAGTGTTTTAAA

Gene: Sama_1816: fatty acid degradation transcriptional regulator, TetR family
*
Shewanella loihica PV-4

Site:
position = -39
score = 6.16422
sequence = ATTTAAACACACGTTTAAAT

Gene: Shew_2052: fatty acid degradation transcriptional regulator, TetR family
*
Shewanella pealeana ATCC 700345

Site:
position = -39
score = 5.8724
sequence = ATTTAAACGAGTGTTTTAAA

Gene: Spea_2339: fatty acid degradation transcriptional regulator, TetR family
*
Shewanella halifaxensis HAW-EB4

Site:
position = -25
score = 5.94489
sequence = ATTTAAACGAGTGTTTAAAA

Gene: Shal_1945: fatty acid degradation transcriptional regulator, TetR family
*
Shewanella piezotolerans WP3

Site:
position = -41
score = 6.19208
sequence = ATTTAAACGAGTGTTTAAAT

Gene: swp_2385: fatty acid degradation transcriptional regulator, TetR family
*
Shewanella sediminis HAW-EB3

Site:
position = -40
score = 6.00889
sequence = ATTTAAACGGGTGTTTAAAA

Gene: Ssed_2066: fatty acid degradation transcriptional regulator, TetR family
*
Shewanella woodyi ATCC 51908

Site:
position = -41
score = 5.8724
sequence = ATTTAAACGAGTGTTTTAAA

Gene: Swoo_2543: fatty acid degradation transcriptional regulator, TetR family
fatty acid degradation transcriptional regulator, TetR family
fadE1
 
Shewanella oneidensis MR-1

Gene: SO_2492: oxidoreductase, acyl-CoA dehydrogenase family
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1863: oxidoreductase, acyl-CoA dehydrogenase family
 
Shewanella sp W3-18-1

Gene: Sputw3181_2146: oxidoreductase, acyl-CoA dehydrogenase family
 
Shewanella sp ANA-3

Gene: Shewana3_2154: oxidoreductase, acyl-CoA dehydrogenase family
 
Shewanella sp MR-4

Gene: Shewmr4_2049: oxidoreductase, acyl-CoA dehydrogenase family
 
Shewanella sp MR-7

Gene: Shewmr7_1926: oxidoreductase, acyl-CoA dehydrogenase family
 
Shewanella baltica OS155

Gene: Sbal_2244: oxidoreductase, acyl-CoA dehydrogenase family
 
Shewanella denitrificans OS217

Gene: Sden_2115: oxidoreductase, acyl-CoA dehydrogenase family
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_1889: oxidoreductase, acyl-CoA dehydrogenase family
 
Shewanella amazonensis SB2B

Gene: Sama_1815: oxidoreductase, acyl-CoA dehydrogenase family
 
Shewanella loihica PV-4

Gene: Shew_2051: oxidoreductase, acyl-CoA dehydrogenase family
 
Shewanella pealeana ATCC 700345

Gene: Spea_2338: oxidoreductase, acyl-CoA dehydrogenase family
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_1946: oxidoreductase, acyl-CoA dehydrogenase family
 
Shewanella piezotolerans WP3

Gene: swp_2386: oxidoreductase, acyl-CoA dehydrogenase family
 
Shewanella sediminis HAW-EB3

Gene: Ssed_2067: oxidoreductase, acyl-CoA dehydrogenase family
 
Shewanella woodyi ATCC 51908

Gene: Swoo_2542: oxidoreductase, acyl-CoA dehydrogenase family
oxidoreductase, acyl-CoA dehydrogenase family
 
CRON 5.
fadH
*
Shewanella oneidensis MR-1

Site:
position = -18
score = 5.35772
sequence = TTTAAAAAGGATGTTTGAAT

Site:
position = -31
score = 5.04439
sequence = TTTAAATCACTTGTTTAAAA

Gene: SO_2419: NADP-dependent 2,4-dienoyl-CoA reductase
*
Shewanella putrefaciens CN-32

Site:
position = -31
score = 4.9719
sequence = TTTAAATCACTTGTTTTAAA

Site:
position = -18
score = 5.4302
sequence = TTTTAAAAGGATGTTTGAAT

Gene: Sputcn32_2077: NADP-dependent 2,4-dienoyl-CoA reductase
*
Shewanella sp W3-18-1

Site:
position = -18
score = 5.4302
sequence = TTTTAAAAGGATGTTTGAAT

Site:
position = -31
score = 4.9719
sequence = TTTAAATCACTTGTTTTAAA

Gene: Sputw3181_1935: NADP-dependent 2,4-dienoyl-CoA reductase
*
Shewanella sp ANA-3

Site:
position = -18
score = 5.35772
sequence = TTTAAAAAGGATGTTTGAAT

Site:
position = -31
score = 5.04439
sequence = TTTAAATCACTTGTTTAAAA

Gene: Shewana3_1965: NADP-dependent 2,4-dienoyl-CoA reductase
*
Shewanella sp MR-4

Site:
position = -31
score = 5.04439
sequence = TTTAAATCACTTGTTTAAAA

Site:
position = -18
score = 5.35772
sequence = TTTAAAAAGGATGTTTGAAT

Gene: Shewmr4_1910: NADP-dependent 2,4-dienoyl-CoA reductase
*
Shewanella sp MR-7

Site:
position = -31
score = 5.04439
sequence = TTTAAATCACTTGTTTAAAA

Site:
position = -18
score = 5.35772
sequence = TTTAAAAAGGATGTTTGAAT

Gene: Shewmr7_2068: NADP-dependent 2,4-dienoyl-CoA reductase
*
Shewanella baltica OS155

Site:
position = -18
score = 5.4302
sequence = TTTTAAAAGGATGTTTGAAT

Site:
position = -31
score = 4.9719
sequence = TTTAAATCACTTGTTTTAAA

Gene: Sbal_2056: NADP-dependent 2,4-dienoyl-CoA reductase
*
Shewanella denitrificans OS217

Site:
position = -18
score = 5.35772
sequence = TTTAAAAAGGATGTTTGAAT

Site:
position = -31
score = 5.04439
sequence = TTTAAATCACTTGTTTAAAA

Gene: Sden_1900: NADP-dependent 2,4-dienoyl-CoA reductase
*
Shewanella frigidimarina NCIMB 400

Site:
position = -84
score = 5.26322
sequence = TAACAAACGAGCGTTTAAAT

Site:
position = -18
score = 5.35772
sequence = TTTAAAAAGGATGTTTGAAT

Site:
position = -31
score = 5.04439
sequence = TTTAAATCACTTGTTTAAAA

Gene: Sfri_2144: NADP-dependent 2,4-dienoyl-CoA reductase
*
Shewanella amazonensis SB2B

Site:
position = -18
score = 5.50322
sequence = TTTTAAAAGGGTGTTTGAAT

Gene: Sama_1724: NADP-dependent 2,4-dienoyl-CoA reductase
*
Shewanella loihica PV-4

Site:
position = -31
score = 5.04439
sequence = TTTAAATCACTTGTTTAAAA

Site:
position = -18
score = 5.39023
sequence = TTTAAAAAGGATGTTTAAAT

Gene: Shew_1942: NADP-dependent 2,4-dienoyl-CoA reductase
*
Shewanella pealeana ATCC 700345

Site:
position = -31
score = 5.29159
sequence = ATTAAATCACTTGTTTAAAA

Site:
position = -18
score = 5.35772
sequence = TTTAAAAAGGATGTTTGAAT

Gene: Spea_2252: NADP-dependent 2,4-dienoyl-CoA reductase
*
Shewanella halifaxensis HAW-EB4

Site:
position = -18
score = 5.35772
sequence = TTTAAAAAGGATGTTTGAAT

Site:
position = -31
score = 5.03452
sequence = ATTGAATCACTTGTTTAAAA

Gene: Shal_2030: NADP-dependent 2,4-dienoyl-CoA reductase
*
Shewanella piezotolerans WP3

Site:
position = -18
score = 5.35772
sequence = TTTAAAAAGGATGTTTGAAT

Site:
position = -31
score = 5.29159
sequence = ATTAAATCACTTGTTTAAAA

Gene: swp_2472: NADP-dependent 2,4-dienoyl-CoA reductase
*
Shewanella sediminis HAW-EB3

Site:
position = -18
score = 5.35772
sequence = TTTAAAAAGGATGTTTGAAT

Site:
position = -31
score = 5.04439
sequence = TTTAAATCACTTGTTTAAAA

Gene: Ssed_2310: NADP-dependent 2,4-dienoyl-CoA reductase
*
Shewanella woodyi ATCC 51908

Site:
position = -18
score = 5.4302
sequence = TTTTAAAAGGATGTTTGAAT

Site:
position = -31
score = 4.99075
sequence = TTTAAATCAGTTGTTTTAAA

Gene: Swoo_2300: NADP-dependent 2,4-dienoyl-CoA reductase
NADP-dependent 2,4-dienoyl-CoA reductase
 
CRON 6.
Sbal_0657
 
Shewanella oneidensis MR-1
*
Shewanella putrefaciens CN-32

Site:
position = -42
score = 5.03552
sequence = ATTCGAACGCACGTTTAACT

Gene: Sputcn32_3181: hypothetical protein
*
Shewanella sp W3-18-1

Site:
position = -42
score = 5.03552
sequence = ATTCGAACGCACGTTTAACT

Gene: Sputw3181_0762: hypothetical protein
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
*
Shewanella baltica OS155

Site:
position = -42
score = 5.36131
sequence = ATTCGAACACACGTTTAATT

Gene: Sbal_0657: hypothetical protein
*
Shewanella denitrificans OS217

Site:
position = -46
score = 5.45103
sequence = ATTCAAGCGAGCGTTTGAAT

Gene: Sden_0953: hypothetical protein
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908

Gene: Swoo_2460: hypothetical protein
hypothetical protein
 
CRON 7.
SO2935
*
Shewanella oneidensis MR-1

Site:
position = -73
score = 4.46054
sequence = TTTGAAACATGCGTTTAGCA

Site:
position = -86
score = 4.49927
sequence = TTTCATTCATTTGTTTGAAA

Gene: SO_2935: oxidoreductase, short-chain dehydrogenase/reductase family
*
Shewanella putrefaciens CN-32

Site:
position = -73
score = 4.46054
sequence = TTTGAAACATGCGTTTATCA

Site:
position = -86
score = 4.49927
sequence = TTTCATTCATTTGTTTGAAA

Gene: Sputcn32_2396: oxidoreductase, short-chain dehydrogenase/reductase family
*
Shewanella sp W3-18-1

Site:
position = -86
score = 4.49927
sequence = TTTCATTCATTTGTTTGAAA

Site:
position = -73
score = 4.46054
sequence = TTTGAAACATGCGTTTATCA

Gene: Sputw3181_1612: oxidoreductase, short-chain dehydrogenase/reductase family
*
Shewanella sp ANA-3

Site:
position = -73
score = 4.46054
sequence = TTTGAAACATGCGTTTAGCA

Site:
position = -86
score = 4.49927
sequence = TTTCATTCATTTGTTTGAAA

Gene: Shewana3_1528: oxidoreductase, short-chain dehydrogenase/reductase family
*
Shewanella sp MR-4

Site:
position = -73
score = 4.46054
sequence = TTTGAAACATGCGTTTAGCA

Site:
position = -86
score = 4.49927
sequence = TTTCATTCATTTGTTTGAAA

Gene: Shewmr4_1468: oxidoreductase, short-chain dehydrogenase/reductase family
*
Shewanella sp MR-7

Site:
position = -73
score = 4.46054
sequence = TTTGAAACATGCGTTTAGCA

Site:
position = -86
score = 4.49927
sequence = TTTCATTCATTTGTTTGAAA

Gene: Shewmr7_1534: oxidoreductase, short-chain dehydrogenase/reductase family
*
Shewanella baltica OS155

Site:
position = -73
score = 4.46054
sequence = TTTGAAACATGCGTTTATCA

Site:
position = -86
score = 4.49927
sequence = TTTCATTCATTTGTTTGAAA

Gene: Sbal_2694: oxidoreductase, short-chain dehydrogenase/reductase family
*
Shewanella denitrificans OS217

Site:
position = -73
score = 5.30323
sequence = TTTAAAACAATCGTTTACTT

Gene: Sden_2473: oxidoreductase, short-chain dehydrogenase/reductase family
*
Shewanella frigidimarina NCIMB 400

Site:
position = -73
score = 5.28206
sequence = TTTCAAACGGTCGTTTATTT

Site:
position = -86
score = 4.57234
sequence = TATTAATCATTTGTTTCAAA

Gene: Sfri_2572: oxidoreductase, short-chain dehydrogenase/reductase family
*
Shewanella amazonensis SB2B

Site:
position = -73
score = 5.1431
sequence = TTTTAAACAGCTGTATGACT

Gene: Sama_2121: oxidoreductase, short-chain dehydrogenase/reductase family
*
Shewanella loihica PV-4

Site:
position = -74
score = 4.38445
sequence = TTTTAAACATTCGTTTCAGG

Site:
position = -87
score = 4.42185
sequence = AATCAGTCATTTGTTTTAAA

Gene: Shew_2409: oxidoreductase, short-chain dehydrogenase/reductase family
*
Shewanella pealeana ATCC 700345

Site:
position = -73
score = 4.87592
sequence = TTTAAAACAGCTGTTTATCA

Site:
position = -86
score = 4.50644
sequence = GATTAATCGTTTGTTTAAAA

Gene: Spea_1649: oxidoreductase, short-chain dehydrogenase/reductase family
*
Shewanella halifaxensis HAW-EB4

Site:
position = -73
score = 4.87592
sequence = TTTAAAACAGCTGTTTATCA

Gene: Shal_2614: oxidoreductase, short-chain dehydrogenase/reductase family
*
Shewanella piezotolerans WP3

Site:
position = -73
score = 4.95345
sequence = TTTAAAACAGCTGTTTACCA

Site:
position = -86
score = 5.10148
sequence = AATTAATCGTTTGTTTAAAA

Gene: swp_1930: oxidoreductase, short-chain dehydrogenase/reductase family
*
Shewanella sediminis HAW-EB3

Site:
position = -86
score = 5.0766
sequence = AATTAATCATTTGTTTTAAA

Gene: Ssed_1692: oxidoreductase, short-chain dehydrogenase/reductase family
*
Shewanella woodyi ATCC 51908

Site:
position = -86
score = 5.0766
sequence = AATTAATCATTTGTTTTAAA

Gene: Swoo_2905: oxidoreductase, short-chain dehydrogenase/reductase family
oxidoreductase, short-chain dehydrogenase/reductase family
 
CRON 8.
SO0080
 
Shewanella oneidensis MR-1

Gene: SO_0080: thioesterase superfamily protein
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_0066: thioesterase superfamily protein
 
Shewanella sp W3-18-1

Gene: Sputw3181_4011: thioesterase superfamily protein
 
Shewanella sp ANA-3

Gene: Shewana3_0085: thioesterase superfamily protein
 
Shewanella sp MR-4

Gene: Shewmr4_0084: thioesterase superfamily protein
 
Shewanella sp MR-7

Gene: Shewmr7_0081: thioesterase superfamily protein
 
Shewanella baltica OS155

Gene: Sbal_4269: thioesterase superfamily protein
*
Shewanella denitrificans OS217

Site:
position = -20
score = 5.26322
sequence = TACCAAACGAGCGTTTAAAT

Gene: Sden_0074: thioesterase superfamily protein
*
Shewanella frigidimarina NCIMB 400

Site:
position = -44
score = 6.05011
sequence = ATTTAAACAAGCGTTTAATT

Gene: Sfri_3968: thioesterase superfamily protein
*
Shewanella amazonensis SB2B

Site:
position = -21
score = 5.44705
sequence = TGTTAAACAATCGTTTGAAT

Gene: Sama_0073: thioesterase superfamily protein
*
Shewanella loihica PV-4

Site:
position = -35
score = 5.35843
sequence = AACTAAACACTTGTTTGAAA

Gene: Shew_3772: thioesterase superfamily protein
*
Shewanella pealeana ATCC 700345

Site:
position = -70
score = 5.85477
sequence = AGTTAAACAGCCGTTTAAAT

Gene: Spea_4183: thioesterase superfamily protein
*
Shewanella halifaxensis HAW-EB4

Site:
position = -47
score = 5.58552
sequence = AATTAAACAGCTGTTTAAAC

Gene: Shal_0066: thioesterase superfamily protein
*
Shewanella piezotolerans WP3

Site:
position = -49
score = 5.75672
sequence = AATCAAACAACCGTTTGAAA

Gene: swp_0119: thioesterase superfamily protein
*
Shewanella sediminis HAW-EB3

Site:
position = -32
score = 5.75825
sequence = AGTTAAACAACCGTTTGAAT

Gene: Ssed_4456: thioesterase superfamily protein
*
Shewanella woodyi ATCC 51908

Site:
position = -50
score = 5.67902
sequence = AGTCAAACGCATGTTTGAAT

Gene: Swoo_4857: thioesterase superfamily protein
thioesterase superfamily protein
 
CRON 9.
SO0881
*
Shewanella oneidensis MR-1

Site:
position = -78
score = 5.94976
sequence = ATTAAAACGTGTGTTTAATT

Gene: SO_0881: conserved hypothetical protein
*
Shewanella putrefaciens CN-32

Site:
position = -77
score = 5.87674
sequence = ATTAAAACGTATGTTTAATT

Gene: Sputcn32_3121: conserved hypothetical protein
*
Shewanella sp W3-18-1

Site:
position = -77
score = 5.87674
sequence = ATTAAAACGTATGTTTAATT

Gene: Sputw3181_0822: conserved hypothetical protein
*
Shewanella sp ANA-3

Site:
position = -78
score = 5.94976
sequence = ATTAAAACGTGTGTTTAATT

Gene: Shewana3_3397: conserved hypothetical protein
*
Shewanella sp MR-4

Site:
position = -78
score = 5.94976
sequence = ATTAAAACGTGTGTTTAATT

Gene: Shewmr4_0737: conserved hypothetical protein
*
Shewanella sp MR-7

Site:
position = -78
score = 5.94976
sequence = ATTAAAACGTGTGTTTAATT

Gene: Shewmr7_3285: conserved hypothetical protein
*
Shewanella baltica OS155

Site:
position = -155
score = 5.94976
sequence = ATTAAAACGTGTGTTTAATT

Gene: Sbal_3483: conserved hypothetical protein
 
Shewanella denitrificans OS217

Gene: Sden_3185: conserved hypothetical protein
*
Shewanella frigidimarina NCIMB 400

Site:
position = -81
score = 6.0912
sequence = ATTTAAACGTATGTTTAAAT

Gene: Sfri_3287: conserved hypothetical protein
*
Shewanella amazonensis SB2B

Site:
position = -151
score = 5.73477
sequence = AATAAAACGTATGTTTAATT

Gene: Sama_2999: conserved hypothetical protein
*
Shewanella loihica PV-4

Site:
position = -116
score = 5.99736
sequence = ATTAAAACATGTGTTTAATT

Gene: Shew_0590: conserved hypothetical protein
*
Shewanella pealeana ATCC 700345

Site:
position = -145
score = 5.94976
sequence = ATTAAAACGTGTGTTTAATT

Site:
position = -98
score = 4.69214
sequence = TTTTAAACTGGTCTTTTATT

Gene: Spea_3504: conserved hypothetical protein
*
Shewanella halifaxensis HAW-EB4

Site:
position = -146
score = 5.87674
sequence = ATTAAAACGTATGTTTAATT

Gene: Shal_3598: conserved hypothetical protein
*
Shewanella piezotolerans WP3

Site:
position = -175
score = 5.94976
sequence = ATTAAAACGTGTGTTTAATT

Gene: swp_0761: conserved hypothetical protein
*
Shewanella sediminis HAW-EB3

Site:
position = -260
score = 5.94976
sequence = ATTAAAACGTGTGTTTAATT

Gene: Ssed_3864: conserved hypothetical protein
 
Shewanella woodyi ATCC 51908

Gene: Swoo_0671: conserved hypothetical protein
conserved hypothetical protein
SO0882
 
Shewanella oneidensis MR-1

Gene: SO_0882: oxidoreductase, GMC family
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_3120: oxidoreductase, GMC family
 
Shewanella sp W3-18-1

Gene: Sputw3181_0823: oxidoreductase, GMC family
 
Shewanella sp ANA-3

Gene: Shewana3_3396: oxidoreductase, GMC family
 
Shewanella sp MR-4

Gene: Shewmr4_0738: oxidoreductase, GMC family
 
Shewanella sp MR-7

Gene: Shewmr7_3284: oxidoreductase, GMC family
 
Shewanella baltica OS155

Gene: Sbal_3482: oxidoreductase, GMC family
 
Shewanella denitrificans OS217

Gene: Sden_3184: oxidoreductase, GMC family
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_3286: oxidoreductase, GMC family
 
Shewanella amazonensis SB2B

Gene: Sama_2998: oxidoreductase, GMC family
 
Shewanella loihica PV-4

Gene: Shew_0591: oxidoreductase, GMC family
 
Shewanella pealeana ATCC 700345

Gene: Spea_3503: oxidoreductase, GMC family
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_3597: oxidoreductase, GMC family
 
Shewanella piezotolerans WP3

Gene: swp_0762: oxidoreductase, GMC family
 
Shewanella sediminis HAW-EB3

Gene: Ssed_3863: oxidoreductase, GMC family
 
Shewanella woodyi ATCC 51908

Gene: Swoo_0672: oxidoreductase, GMC family
oxidoreductase, GMC family
 
CRON 10.
fadE3
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
*
Shewanella loihica PV-4

Site:
position = -199
score = 4.92959
sequence = ATTCAAACAATTATATGAAA

Site:
position = -186
score = 5.52097
sequence = TATGAAACAAGTGTTTAAAT

Gene: Shew_3003: acyl-CoA dehydrogenase
*
Shewanella pealeana ATCC 700345

Site:
position = -99
score = 5.62452
sequence = ATCCAAACGCACGTTTAAAT

Gene: Spea_1234: acyl-CoA dehydrogenase
*
Shewanella halifaxensis HAW-EB4

Site:
position = -98
score = 5.69999
sequence = ATCCAAACAAGCGTTTAAAT

Gene: Shal_1266: acyl-CoA dehydrogenase
*
Shewanella piezotolerans WP3

Site:
position = -98
score = 5.75136
sequence = ATCTAAACAACCGTTTAAAT

Gene: swp_3422: acyl-CoA dehydrogenase
 
Shewanella sediminis HAW-EB3
*
Shewanella woodyi ATCC 51908

Site:
position = -98
score = 6.16202
sequence = ATTCAAACAATTGTTTAAAT

Gene: Swoo_1504: acyl-CoA dehydrogenase
acyl-CoA dehydrogenase
 
CRON 11.
etfB
*
Shewanella oneidensis MR-1

Site:
position = -121
score = 5.38885
sequence = ATGCAAACAGGCGTTTGACT

Gene: SO_3145: electron transfer flavoprotein, beta subunit
*
Shewanella putrefaciens CN-32

Site:
position = -121
score = 5.20103
sequence = ATGCAAACAGTCGTTTGAGT

Gene: Sputcn32_2511: electron transfer flavoprotein, beta subunit
*
Shewanella sp W3-18-1

Site:
position = -121
score = 5.20103
sequence = ATGCAAACAGTCGTTTGAGT

Gene: Sputw3181_1497: electron transfer flavoprotein, beta subunit
*
Shewanella sp ANA-3

Site:
position = -121
score = 5.24618
sequence = ATGCAAACAGGCGTTTGAGT

Gene: Shewana3_1405: electron transfer flavoprotein, beta subunit
*
Shewanella sp MR-4

Site:
position = -121
score = 5.24618
sequence = ATGCAAACAGGCGTTTGAGT

Gene: Shewmr4_1352: electron transfer flavoprotein, beta subunit
*
Shewanella sp MR-7

Site:
position = -121
score = 5.24618
sequence = ATGCAAACAGGCGTTTGAGT

Gene: Shewmr7_1417: electron transfer flavoprotein, beta subunit
*
Shewanella baltica OS155

Site:
position = -121
score = 5.38885
sequence = ATGCAAACAGGCGTTTGACT

Gene: Sbal_2847: electron transfer flavoprotein, beta subunit
*
Shewanella denitrificans OS217

Site:
position = -120
score = 5.11017
sequence = ATGCAAACGCTTGTTTAACA

Gene: Sden_2539: electron transfer flavoprotein, beta subunit
*
Shewanella frigidimarina NCIMB 400

Site:
position = -122
score = 5.37621
sequence = ATGTAAACAGTCGTTTGACT

Gene: Sfri_2748: electron transfer flavoprotein, beta subunit
 
Shewanella amazonensis SB2B

Gene: Sama_1169: electron transfer flavoprotein, beta subunit
 
Shewanella loihica PV-4

Gene: Shew_2584: electron transfer flavoprotein, beta subunit
 
Shewanella pealeana ATCC 700345

Gene: Spea_2855: electron transfer flavoprotein, beta subunit
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2945: electron transfer flavoprotein, beta subunit
 
Shewanella piezotolerans WP3

Gene: swp_3472: electron transfer flavoprotein, beta subunit
*
Shewanella sediminis HAW-EB3

Site:
position = -120
score = 5.63872
sequence = ATACAAACGGTCGTTTGAAT

Gene: Ssed_1445: electron transfer flavoprotein, beta subunit
*
Shewanella woodyi ATCC 51908

Site:
position = -123
score = 5.43667
sequence = ATACAAACGGGCGTTTGAAA

Gene: Swoo_3236: electron transfer flavoprotein, beta subunit
electron transfer flavoprotein, beta subunit
etfA
 
Shewanella oneidensis MR-1

Gene: SO_3144: electron transfer flavoprotein, alpha subunit
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2510: electron transfer flavoprotein, alpha subunit
 
Shewanella sp W3-18-1

Gene: Sputw3181_1498: electron transfer flavoprotein, alpha subunit
 
Shewanella sp ANA-3

Gene: Shewana3_1406: electron transfer flavoprotein, alpha subunit
 
Shewanella sp MR-4

Gene: Shewmr4_1353: electron transfer flavoprotein, alpha subunit
 
Shewanella sp MR-7

Gene: Shewmr7_1418: electron transfer flavoprotein, alpha subunit
 
Shewanella baltica OS155

Gene: Sbal_2846: electron transfer flavoprotein, alpha subunit
 
Shewanella denitrificans OS217

Gene: Sden_2538: electron transfer flavoprotein, alpha subunit
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2747: electron transfer flavoprotein, alpha subunit
 
Shewanella amazonensis SB2B

Gene: Sama_1170: electron transfer flavoprotein, alpha subunit
 
Shewanella loihica PV-4

Gene: Shew_2583: electron transfer flavoprotein, alpha subunit
 
Shewanella pealeana ATCC 700345

Gene: Spea_2854: electron transfer flavoprotein, alpha subunit
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2944: electron transfer flavoprotein, alpha subunit
 
Shewanella piezotolerans WP3

Gene: swp_3471: electron transfer flavoprotein, alpha subunit
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1446: electron transfer flavoprotein, alpha subunit
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3235: electron transfer flavoprotein, alpha subunit
electron transfer flavoprotein, alpha subunit
 
CRON 12.
etfD
*
Shewanella oneidensis MR-1

Site:
position = -70
score = 5.36478
sequence = AATAAAACGCCCGTTTACAA

Gene: SO_4453: electron-transferring-flavoprotein dehydrogenase
*
Shewanella putrefaciens CN-32

Site:
position = -70
score = 5.36478
sequence = AATAAAACGCCCGTTTACAA

Gene: Sputcn32_0388: electron-transferring-flavoprotein dehydrogenase
*
Shewanella sp W3-18-1

Site:
position = -70
score = 5.36478
sequence = AATAAAACGCCCGTTTACAA

Gene: Sputw3181_0242: electron-transferring-flavoprotein dehydrogenase
*
Shewanella sp ANA-3

Site:
position = -74
score = 5.36478
sequence = AATAAAACGCCCGTTTACAA

Gene: Shewana3_0273: electron-transferring-flavoprotein dehydrogenase
*
Shewanella sp MR-4

Site:
position = -74
score = 5.36478
sequence = AATAAAACGCCCGTTTACAA

Gene: Shewmr4_0272: electron-transferring-flavoprotein dehydrogenase
*
Shewanella sp MR-7

Site:
position = -74
score = 5.36478
sequence = AATAAAACGCCCGTTTACAA

Gene: Shewmr7_3749: electron-transferring-flavoprotein dehydrogenase
*
Shewanella baltica OS155

Site:
position = -70
score = 5.36478
sequence = AATAAAACGCCCGTTTACAA

Gene: Sbal_0283: electron-transferring-flavoprotein dehydrogenase
 
Shewanella denitrificans OS217

Gene: Sden_0100: electron-transferring-flavoprotein dehydrogenase
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0081: electron-transferring-flavoprotein dehydrogenase
*
Shewanella amazonensis SB2B

Site:
position = -51
score = 5.41239
sequence = TATAAAACACCCGTTTACAT

Gene: Sama_3523: electron-transferring-flavoprotein dehydrogenase
*
Shewanella loihica PV-4

Site:
position = -47
score = 5.71207
sequence = AATAAAACACCCGTTTCAAT

Gene: Shew_0086: electron-transferring-flavoprotein dehydrogenase
*
Shewanella pealeana ATCC 700345

Site:
position = -80
score = 5.12898
sequence = ATTAAAACACCCGTTTATAG

Gene: Spea_4121: electron-transferring-flavoprotein dehydrogenase
*
Shewanella halifaxensis HAW-EB4

Site:
position = -79
score = 5.12898
sequence = ATTAAAACACCCGTTTATAG

Gene: Shal_0121: electron-transferring-flavoprotein dehydrogenase
*
Shewanella piezotolerans WP3

Site:
position = -76
score = 5.12898
sequence = ATTAAAACACCCGTTTATAG

Gene: swp_5010: electron-transferring-flavoprotein dehydrogenase
*
Shewanella sediminis HAW-EB3

Site:
position = -49
score = 5.16839
sequence = ATTAAAACACCCGTTTAACG

Gene: Ssed_4403: electron-transferring-flavoprotein dehydrogenase
*
Shewanella woodyi ATCC 51908

Site:
position = -45
score = 5.16839
sequence = ATTAAAACACCCGTTTAACG

Gene: Swoo_4794: electron-transferring-flavoprotein dehydrogenase
electron-transferring-flavoprotein dehydrogenase
 
CRON 13.
sdhC
*
Shewanella oneidensis MR-1

Site:
position = -331
score = 5.71894
sequence = ATTTAAATAAGCGTTTAAAT

Gene: SO_1927: succinate dehydrogenase, cytochrome b556 subunit
*
Shewanella putrefaciens CN-32

Site:
position = -331
score = 5.71894
sequence = ATTTAAATAAGCGTTTAAAT

Gene: Sputcn32_2273: succinate dehydrogenase, cytochrome b556 subunit
*
Shewanella sp W3-18-1

Site:
position = -331
score = 5.71894
sequence = ATTTAAATAAGCGTTTAAAT

Gene: Sputw3181_1735: succinate dehydrogenase, cytochrome b556 subunit
*
Shewanella sp ANA-3

Site:
position = -331
score = 5.71894
sequence = ATTTAAATAAGCGTTTAAAT

Gene: Shewana3_1706: succinate dehydrogenase, cytochrome b556 subunit
*
Shewanella sp MR-4

Site:
position = -331
score = 5.71894
sequence = ATTTAAATAAGCGTTTAAAT

Gene: Shewmr4_1631: succinate dehydrogenase, cytochrome b556 subunit
*
Shewanella sp MR-7

Site:
position = -331
score = 5.71894
sequence = ATTTAAATAAGCGTTTAAAT

Gene: Shewmr7_1706: succinate dehydrogenase, cytochrome b556 subunit
*
Shewanella baltica OS155

Site:
position = -330
score = 5.71894
sequence = ATTTAAATAAGCGTTTAAAT

Gene: Sbal_2519: succinate dehydrogenase, cytochrome b556 subunit
*
Shewanella denitrificans OS217

Site:
position = -374
score = 5.57696
sequence = ATTTAAATAAGCGTTTAATT

Gene: Sden_2187: succinate dehydrogenase, cytochrome b556 subunit
*
Shewanella frigidimarina NCIMB 400

Site:
position = -324
score = 5.71894
sequence = ATTTAAATAAGCGTTTAAAT

Gene: Sfri_2347: succinate dehydrogenase, cytochrome b556 subunit
*
Shewanella amazonensis SB2B

Site:
position = -327
score = 5.71894
sequence = ATTTAAATAAGCGTTTAAAT

Gene: Sama_1423: succinate dehydrogenase, cytochrome b556 subunit
*
Shewanella loihica PV-4

Site:
position = -329
score = 5.76654
sequence = ATTTAAATAAGTGTTTAAAT

Gene: Shew_1651: succinate dehydrogenase, cytochrome b556 subunit
*
Shewanella pealeana ATCC 700345

Site:
position = -351
score = 5.71894
sequence = ATTTAAATAAGCGTTTAAAT

Gene: Spea_1784: succinate dehydrogenase, cytochrome b556 subunit
*
Shewanella halifaxensis HAW-EB4

Site:
position = -350
score = 5.71894
sequence = ATTTAAATAAGCGTTTAAAT

Gene: Shal_2493: succinate dehydrogenase, cytochrome b556 subunit
*
Shewanella piezotolerans WP3

Site:
position = -284
score = 5.71894
sequence = ATTTAAATAAGCGTTTAAAT

Gene: swp_2955: succinate dehydrogenase, cytochrome b556 subunit
*
Shewanella sediminis HAW-EB3

Site:
position = -349
score = 5.76654
sequence = ATTTAAATAAGTGTTTAAAT

Gene: Ssed_2818: succinate dehydrogenase, cytochrome b556 subunit
*
Shewanella woodyi ATCC 51908

Site:
position = -351
score = 5.73778
sequence = ATTTAAATAACCGTTTAAAT

Gene: Swoo_1833: succinate dehydrogenase, cytochrome b556 subunit
succinate dehydrogenase, cytochrome b556 subunit
sdhD
 
Shewanella oneidensis MR-1

Gene: SO_1927.1: succinate dehydrogenase subunit D
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2272: succinate dehydrogenase subunit D
 
Shewanella sp W3-18-1

Gene: Sputw3181_1736: succinate dehydrogenase subunit D
 
Shewanella sp ANA-3

Gene: Shewana3_1707: succinate dehydrogenase subunit D
 
Shewanella sp MR-4

Gene: Shewmr4_1632: succinate dehydrogenase subunit D
 
Shewanella sp MR-7

Gene: Shewmr7_1707: succinate dehydrogenase subunit D
 
Shewanella baltica OS155

Gene: Sbal_2518: succinate dehydrogenase subunit D
 
Shewanella denitrificans OS217

Gene: Sden_2186: succinate dehydrogenase subunit D
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2346: succinate dehydrogenase subunit D
 
Shewanella amazonensis SB2B

Gene: Sama_1424: succinate dehydrogenase subunit D
 
Shewanella loihica PV-4

Gene: Shew_1652: succinate dehydrogenase subunit D
 
Shewanella pealeana ATCC 700345

Gene: Spea_1785: succinate dehydrogenase subunit D
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2492: succinate dehydrogenase subunit D
 
Shewanella piezotolerans WP3

Gene: swp_2953: succinate dehydrogenase subunit D
 
Shewanella sediminis HAW-EB3

Gene: Ssed_2817: succinate dehydrogenase subunit D
 
Shewanella woodyi ATCC 51908

Gene: Swoo_1834: succinate dehydrogenase subunit D
succinate dehydrogenase subunit D
sdhA
 
Shewanella oneidensis MR-1

Gene: SO_1928: succinate dehydrogenase, flavoprotein subunit
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2271: succinate dehydrogenase, flavoprotein subunit
 
Shewanella sp W3-18-1

Gene: Sputw3181_1737: succinate dehydrogenase, flavoprotein subunit
 
Shewanella sp ANA-3

Gene: Shewana3_1708: succinate dehydrogenase, flavoprotein subunit
 
Shewanella sp MR-4

Gene: Shewmr4_1633: succinate dehydrogenase, flavoprotein subunit
 
Shewanella sp MR-7

Gene: Shewmr7_1708: succinate dehydrogenase, flavoprotein subunit
 
Shewanella baltica OS155

Gene: Sbal_2517: succinate dehydrogenase, flavoprotein subunit
 
Shewanella denitrificans OS217

Gene: Sden_2185: succinate dehydrogenase, flavoprotein subunit
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2345: succinate dehydrogenase, flavoprotein subunit
 
Shewanella amazonensis SB2B

Gene: Sama_1425: succinate dehydrogenase, flavoprotein subunit
 
Shewanella loihica PV-4

Gene: Shew_1653: succinate dehydrogenase, flavoprotein subunit
 
Shewanella pealeana ATCC 700345

Gene: Spea_1786: succinate dehydrogenase, flavoprotein subunit
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2491: succinate dehydrogenase, flavoprotein subunit
 
Shewanella piezotolerans WP3

Gene: swp_2952: succinate dehydrogenase, flavoprotein subunit
 
Shewanella sediminis HAW-EB3

Gene: Ssed_2816: succinate dehydrogenase, flavoprotein subunit
 
Shewanella woodyi ATCC 51908

Gene: Swoo_1835: succinate dehydrogenase, flavoprotein subunit
succinate dehydrogenase, flavoprotein subunit
sdhB
 
Shewanella oneidensis MR-1

Gene: SO_1929: succinate dehydrogenase, iron-sulfur protein
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2270: succinate dehydrogenase, iron-sulfur protein
 
Shewanella sp W3-18-1

Gene: Sputw3181_1738: succinate dehydrogenase, iron-sulfur protein
 
Shewanella sp ANA-3

Gene: Shewana3_1709: succinate dehydrogenase, iron-sulfur protein
 
Shewanella sp MR-4

Gene: Shewmr4_1634: succinate dehydrogenase, iron-sulfur protein
 
Shewanella sp MR-7

Gene: Shewmr7_1709: succinate dehydrogenase, iron-sulfur protein
 
Shewanella baltica OS155

Gene: Sbal_2516: succinate dehydrogenase, iron-sulfur protein
 
Shewanella denitrificans OS217

Gene: Sden_2184: succinate dehydrogenase, iron-sulfur protein
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2344: succinate dehydrogenase, iron-sulfur protein
 
Shewanella amazonensis SB2B

Gene: Sama_1426: succinate dehydrogenase, iron-sulfur protein
 
Shewanella loihica PV-4

Gene: Shew_1654: succinate dehydrogenase, iron-sulfur protein
 
Shewanella pealeana ATCC 700345

Gene: Spea_1787: succinate dehydrogenase, iron-sulfur protein
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2490: succinate dehydrogenase, iron-sulfur protein
 
Shewanella piezotolerans WP3

Gene: swp_2950: succinate dehydrogenase, iron-sulfur protein
 
Shewanella sediminis HAW-EB3

Gene: Ssed_2815: succinate dehydrogenase, iron-sulfur protein
 
Shewanella woodyi ATCC 51908

Gene: Swoo_1836: succinate dehydrogenase, iron-sulfur protein
succinate dehydrogenase, iron-sulfur protein
 
CRON 14.
aceB
*
Shewanella oneidensis MR-1

Site:
position = -507
score = 5.58716
sequence = AATGAAACGTATGTTTGAAT

Gene: SO_1483: malate synthase A
*
Shewanella putrefaciens CN-32

Site:
position = -439
score = 5.94886
sequence = AATTAAACGGTCGTTTTAAT

Gene: Sputcn32_1238: malate synthase A
*
Shewanella sp W3-18-1

Site:
position = -438
score = 5.94886
sequence = AATTAAACGGTCGTTTTAAT

Gene: Sputw3181_2866: malate synthase A
*
Shewanella sp ANA-3

Site:
position = -507
score = 6.00496
sequence = AATTAAACGATTGTTTAAAT

Gene: Shewana3_2943: malate synthase A
*
Shewanella sp MR-4

Site:
position = -507
score = 5.17688
sequence = AGTTAAACGAGTGTTTAAAC

Gene: Shewmr4_2767: malate synthase A
*
Shewanella sp MR-7

Site:
position = -507
score = 5.77192
sequence = AGTTAAACGAGTGTTTAAAT

Gene: Shewmr7_2845: malate synthase A
*
Shewanella baltica OS155

Site:
position = -515
score = 5.94886
sequence = AATAAAACGGTCGTTTAAAT

Gene: Sbal_1316: malate synthase A
*
Shewanella denitrificans OS217

Site:
position = -470
score = 5.3213
sequence = ATTAAAACGGTCGTTTGATG

Gene: Sden_1245: malate synthase A
*
Shewanella frigidimarina NCIMB 400

Site:
position = -592
score = 5.93885
sequence = TTTAAAACAGTTGTTTAAAT

Gene: Sfri_1101: malate synthase A
*
Shewanella amazonensis SB2B

Site:
position = -499
score = 5.90215
sequence = ATTAAAACGTGCGTTTAATT

Gene: Sama_2381: malate synthase A
*
Shewanella loihica PV-4

Site:
position = -527
score = 5.94265
sequence = ATTAAAACGCGCGTTTGATT

Gene: Shew_1275: malate synthase A
*
Shewanella pealeana ATCC 700345

Site:
position = -550
score = 5.70939
sequence = ATTGAAACGTTCGTTTGAAT

Gene: Spea_1290: malate synthase A
*
Shewanella halifaxensis HAW-EB4

Site:
position = -592
score = 5.58337
sequence = GTTTAAACGGTTGTTTGAAT

Gene: Shal_1352: malate synthase A
*
Shewanella piezotolerans WP3

Site:
position = -547
score = 6.06896
sequence = ATTTAAACGACTGTTTAATT

Gene: swp_1433: malate synthase A
*
Shewanella sediminis HAW-EB3

Site:
position = -506
score = 5.32169
sequence = ATTGAAACGGTCGTATGAAT

Gene: Ssed_1414: malate synthase A
*
Shewanella woodyi ATCC 51908

Site:
position = -536
score = 5.26749
sequence = ATTGAAACGCTTGTTTAAAC

Gene: Swoo_1528: malate synthase A
malate synthase A
aceA
 
Shewanella oneidensis MR-1

Gene: SO_1484: isocitrate lyase
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1239: isocitrate lyase
 
Shewanella sp W3-18-1

Gene: Sputw3181_2865: isocitrate lyase
 
Shewanella sp ANA-3

Gene: Shewana3_2942: isocitrate lyase
 
Shewanella sp MR-4

Gene: Shewmr4_2766: isocitrate lyase
 
Shewanella sp MR-7

Gene: Shewmr7_2844: isocitrate lyase
 
Shewanella baltica OS155

Gene: Sbal_1317: isocitrate lyase
 
Shewanella denitrificans OS217

Gene: Sden_1246: isocitrate lyase
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_1102: isocitrate lyase
 
Shewanella amazonensis SB2B

Gene: Sama_2380: isocitrate lyase
 
Shewanella loihica PV-4

Gene: Shew_1276: isocitrate lyase
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1415: isocitrate lyase
 
Shewanella woodyi ATCC 51908
isocitrate lyase
 
CRON 15.
acdH
*
Shewanella oneidensis MR-1

Site:
position = -41
score = 6.11356
sequence = ATTAAAACAACTGTTTTAAT

Gene: SO_2395: acyl-CoA dehydrogenase family protein
*
Shewanella putrefaciens CN-32

Site:
position = -41
score = 6.11356
sequence = ATTAAAACAACTGTTTTAAT

Gene: Sputcn32_2035: acyl-CoA dehydrogenase family protein
*
Shewanella sp W3-18-1

Site:
position = -41
score = 6.11356
sequence = ATTAAAACAACTGTTTTAAT

Gene: Sputw3181_1978: acyl-CoA dehydrogenase family protein
*
Shewanella sp ANA-3

Site:
position = -41
score = 6.18605
sequence = ATTAAAACAACTGTTTAAAT

Gene: Shewana3_1984: acyl-CoA dehydrogenase family protein
*
Shewanella sp MR-4

Site:
position = -41
score = 6.18605
sequence = ATTAAAACAACTGTTTAAAT

Gene: Shewmr4_1931: acyl-CoA dehydrogenase family protein
*
Shewanella sp MR-7

Site:
position = -41
score = 6.18605
sequence = ATTAAAACAACTGTTTAAAT

Gene: Shewmr7_2047: acyl-CoA dehydrogenase family protein
*
Shewanella baltica OS155

Site:
position = -41
score = 6.11356
sequence = ATTAAAACAACTGTTTTAAT

Gene: Sbal_2077: acyl-CoA dehydrogenase family protein
*
Shewanella denitrificans OS217

Site:
position = -39
score = 6.10682
sequence = ATTAAAACACATGTTTGAAT

Gene: Sden_1761: acyl-CoA dehydrogenase family protein
*
Shewanella frigidimarina NCIMB 400

Site:
position = -40
score = 6.11356
sequence = ATTAAAACAACTGTTTTAAT

Gene: Sfri_2115: acyl-CoA dehydrogenase family protein
*
Shewanella amazonensis SB2B

Site:
position = -40
score = 5.92898
sequence = ATTGAAACAACTGTTTAAAT

Gene: Sama_1743: acyl-CoA dehydrogenase family protein
*
Shewanella loihica PV-4

Site:
position = -41
score = 6.06595
sequence = ATTAAAACGACTGTTTTAAT

Gene: Shew_1961: acyl-CoA dehydrogenase family protein
*
Shewanella pealeana ATCC 700345

Site:
position = -40
score = 5.68179
sequence = TTTGAAACAACTGTTTAAAT

Gene: Spea_2081: acyl-CoA dehydrogenase family protein
*
Shewanella halifaxensis HAW-EB4

Site:
position = -40
score = 5.68179
sequence = TTTGAAACAACTGTTTAAAT

Gene: Shal_2054: acyl-CoA dehydrogenase family protein
*
Shewanella piezotolerans WP3

Site:
position = -40
score = 5.90112
sequence = ATTGAAACATCTGTTTAAAT

Gene: swp_2502: acyl-CoA dehydrogenase family protein
*
Shewanella sediminis HAW-EB3

Site:
position = -40
score = 6.11356
sequence = ATTAAAACAACTGTTTTAAT

Gene: Ssed_2292: acyl-CoA dehydrogenase family protein
*
Shewanella woodyi ATCC 51908

Site:
position = -40
score = 6.11356
sequence = ATTAAAACAACTGTTTTAAT

Gene: Swoo_2323: acyl-CoA dehydrogenase family protein
acyl-CoA dehydrogenase family protein
 
CRON 16.
gltA
*
Shewanella oneidensis MR-1

Site:
position = -105
score = 5.71894
sequence = ATTTAAACGCTTATTTAAAT

Gene: SO_1926: citrate synthase
*
Shewanella putrefaciens CN-32

Site:
position = -105
score = 5.71894
sequence = ATTTAAACGCTTATTTAAAT

Gene: Sputcn32_2274: citrate synthase
*
Shewanella sp W3-18-1

Site:
position = -105
score = 5.71894
sequence = ATTTAAACGCTTATTTAAAT

Gene: Sputw3181_1734: citrate synthase
*
Shewanella sp ANA-3

Site:
position = -105
score = 5.71894
sequence = ATTTAAACGCTTATTTAAAT

Gene: Shewana3_1705: citrate synthase
*
Shewanella sp MR-4

Site:
position = -105
score = 5.71894
sequence = ATTTAAACGCTTATTTAAAT

Gene: Shewmr4_1630: citrate synthase
*
Shewanella sp MR-7

Site:
position = -105
score = 5.71894
sequence = ATTTAAACGCTTATTTAAAT

Gene: Shewmr7_1705: citrate synthase
*
Shewanella baltica OS155

Site:
position = -105
score = 5.71894
sequence = ATTTAAACGCTTATTTAAAT

Gene: Sbal_2520: citrate synthase
*
Shewanella denitrificans OS217

Site:
position = -50
score = 5.57696
sequence = AATTAAACGCTTATTTAAAT

Gene: Sden_2189: citrate synthase
*
Shewanella frigidimarina NCIMB 400

Site:
position = -105
score = 5.71894
sequence = ATTTAAACGCTTATTTAAAT

Gene: Sfri_2348: citrate synthase
*
Shewanella amazonensis SB2B

Site:
position = -105
score = 5.71894
sequence = ATTTAAACGCTTATTTAAAT

Gene: Sama_1422: citrate synthase
*
Shewanella loihica PV-4

Site:
position = -103
score = 5.76654
sequence = ATTTAAACACTTATTTAAAT

Gene: Shew_1650: citrate synthase
*
Shewanella pealeana ATCC 700345

Site:
position = -101
score = 5.71894
sequence = ATTTAAACGCTTATTTAAAT

Gene: Spea_1783: citrate synthase
*
Shewanella halifaxensis HAW-EB4

Site:
position = -101
score = 5.71894
sequence = ATTTAAACGCTTATTTAAAT

Gene: Shal_2494: citrate synthase
*
Shewanella piezotolerans WP3

Site:
position = -101
score = 5.71894
sequence = ATTTAAACGCTTATTTAAAT

Gene: swp_2957: citrate synthase
*
Shewanella sediminis HAW-EB3

Site:
position = -100
score = 5.76654
sequence = ATTTAAACACTTATTTAAAT

Gene: Ssed_2819: citrate synthase
*
Shewanella woodyi ATCC 51908

Site:
position = -100
score = 5.73778
sequence = ATTTAAACGGTTATTTAAAT

Gene: Swoo_1832: citrate synthase
citrate synthase
 
CRON 17.
echH
*
Shewanella oneidensis MR-1

Site:
position = -80
score = 6.05618
sequence = AATTAAACATCTGTTTGAAT

Gene: SO_3908: enoyl-CoA hydratase/isomerase family protein
*
Shewanella putrefaciens CN-32

Site:
position = -80
score = 6.05618
sequence = AATTAAACATCTGTTTGAAT

Gene: Sputcn32_0764: enoyl-CoA hydratase/isomerase family protein
*
Shewanella sp W3-18-1

Site:
position = -80
score = 6.05618
sequence = AATTAAACATCTGTTTGAAT

Gene: Sputw3181_3411: enoyl-CoA hydratase/isomerase family protein
*
Shewanella sp ANA-3

Site:
position = -80
score = 6.05618
sequence = AATTAAACATCTGTTTGAAT

Gene: Shewana3_0721: enoyl-CoA hydratase/isomerase family protein
*
Shewanella sp MR-4

Site:
position = -80
score = 6.05618
sequence = AATTAAACATCTGTTTGAAT

Gene: Shewmr4_3240: enoyl-CoA hydratase/isomerase family protein
*
Shewanella sp MR-7

Site:
position = -80
score = 6.05618
sequence = AATTAAACATCTGTTTGAAT

Gene: Shewmr7_0749: enoyl-CoA hydratase/isomerase family protein
*
Shewanella baltica OS155

Site:
position = -79
score = 6.14805
sequence = AATTAAACAGCTGTTTGAAT

Gene: Sbal_3582: enoyl-CoA hydratase/isomerase family protein
*
Shewanella denitrificans OS217

Site:
position = -81
score = 6.05618
sequence = AATTAAACAGATGTTTGAAT

Gene: Sden_3229: enoyl-CoA hydratase/isomerase family protein
*
Shewanella frigidimarina NCIMB 400

Site:
position = -81
score = 5.778
sequence = AGTTAAACAGATGTTTGAAT

Gene: Sfri_3336: enoyl-CoA hydratase/isomerase family protein
*
Shewanella amazonensis SB2B

Site:
position = -77
score = 6.03734
sequence = AATTAAACATGTGTTTGAAT

Gene: Sama_3052: enoyl-CoA hydratase/isomerase family protein
*
Shewanella loihica PV-4

Site:
position = -80
score = 5.81555
sequence = AATTAAACGCGTGTTTGAAA

Gene: Shew_0540: enoyl-CoA hydratase/isomerase family protein
*
Shewanella pealeana ATCC 700345

Site:
position = -79
score = 5.80586
sequence = AGTTAAACAGTTGTTTGAAT

Gene: Spea_3567: enoyl-CoA hydratase/isomerase family protein
*
Shewanella halifaxensis HAW-EB4

Site:
position = -79
score = 5.21082
sequence = GGTTAAACAGTTGTTTGAAT

Gene: Shal_3661: enoyl-CoA hydratase/isomerase family protein
*
Shewanella piezotolerans WP3

Site:
position = -81
score = 5.55866
sequence = TGTTAAACAGTTGTTTGAAT

Gene: swp_0735: enoyl-CoA hydratase/isomerase family protein
*
Shewanella sediminis HAW-EB3

Site:
position = -78
score = 6.01759
sequence = AATTAAACGCTTGTTTGAAT

Gene: Ssed_0770: enoyl-CoA hydratase/isomerase family protein
*
Shewanella woodyi ATCC 51908

Site:
position = -78
score = 6.0652
sequence = AATTAAACACTTGTTTGAAT

Gene: Swoo_4199: enoyl-CoA hydratase/isomerase family protein
enoyl-CoA hydratase/isomerase family protein
 
CRON 18.
fadE2
*
Shewanella oneidensis MR-1

Site:
position = -157
score = 5.91482
sequence = ATTTAAACAATTGTTTGAAA

Gene: SO_2536: oxidoreductase, acyl-CoA dehydrogenase family
*
Shewanella putrefaciens CN-32

Site:
position = -156
score = 5.91482
sequence = ATTTAAACAATTGTTTGAAA

Gene: Sputcn32_1791: oxidoreductase, acyl-CoA dehydrogenase family
*
Shewanella sp W3-18-1

Site:
position = -156
score = 5.91482
sequence = ATTTAAACAATTGTTTGAAA

Gene: Sputw3181_2234: oxidoreductase, acyl-CoA dehydrogenase family
*
Shewanella sp ANA-3

Site:
position = -156
score = 5.91482
sequence = ATTTAAACAATTGTTTGAAA

Gene: Shewana3_2323: oxidoreductase, acyl-CoA dehydrogenase family
*
Shewanella sp MR-4

Site:
position = -156
score = 5.91482
sequence = ATTTAAACAATTGTTTGAAA

Gene: Shewmr4_2146: oxidoreductase, acyl-CoA dehydrogenase family
*
Shewanella sp MR-7

Site:
position = -156
score = 5.91482
sequence = ATTTAAACAATTGTTTGAAA

Gene: Shewmr7_2223: oxidoreductase, acyl-CoA dehydrogenase family
*
Shewanella baltica OS155

Site:
position = -156
score = 5.91482
sequence = ATTTAAACAATTGTTTGAAA

Gene: Sbal_2306: oxidoreductase, acyl-CoA dehydrogenase family
*
Shewanella denitrificans OS217

Site:
position = -150
score = 5.66762
sequence = TTTTAAACAATTGTTTGAAA

Gene: Sden_1764: oxidoreductase, acyl-CoA dehydrogenase family
*
Shewanella frigidimarina NCIMB 400

Site:
position = -150
score = 5.91482
sequence = ATTTAAACAATTGTTTGAAA

Gene: Sfri_1869: oxidoreductase, acyl-CoA dehydrogenase family
*
Shewanella amazonensis SB2B

Site:
position = -149
score = 5.88696
sequence = ATTTAAACATTTGTTTGAAA

Gene: Sama_1870: oxidoreductase, acyl-CoA dehydrogenase family
*
Shewanella loihica PV-4

Site:
position = -155
score = 5.49466
sequence = AGTTAAACAATTGTTTGAAA

Gene: Shew_2108: oxidoreductase, acyl-CoA dehydrogenase family
*
Shewanella pealeana ATCC 700345

Site:
position = -121
score = 4.8415
sequence = AAATTAACGAACGTTTAAAT

Site:
position = -154
score = 5.74498
sequence = AATTAAACATTTGTTTGAAA

Gene: Spea_2393: oxidoreductase, acyl-CoA dehydrogenase family
*
Shewanella halifaxensis HAW-EB4

Site:
position = -154
score = 6.0247
sequence = ATTTAAACATTTGTTTAATT

Gene: Shal_1890: oxidoreductase, acyl-CoA dehydrogenase family
*
Shewanella piezotolerans WP3

Site:
position = -181
score = 5.88696
sequence = ATTTAAACATTTGTTTGAAA

Gene: swp_2312: oxidoreductase, acyl-CoA dehydrogenase family
*
Shewanella sediminis HAW-EB3

Site:
position = -156
score = 5.59215
sequence = TTTTAAACGTTTGTTTGAAA

Gene: Ssed_1999: oxidoreductase, acyl-CoA dehydrogenase family
*
Shewanella woodyi ATCC 51908

Site:
position = -158
score = 5.79938
sequence = ATTTAAACGTTTGTTTTAAA

Gene: Swoo_2604: oxidoreductase, acyl-CoA dehydrogenase family
oxidoreductase, acyl-CoA dehydrogenase family
 
CRON 19.
fadI
*
Shewanella oneidensis MR-1

Site:
position = -163
score = 5.42243
sequence = AAACAAACAGGTGTTTAAAA

Gene: SO_3089: fatty oxidation complex, beta subunit
*
Shewanella putrefaciens CN-32

Site:
position = -168
score = 5.42243
sequence = AAACAAACAGGTGTTTAAAA

Gene: Sputcn32_2460: fatty oxidation complex, beta subunit
*
Shewanella sp W3-18-1

Site:
position = -168
score = 5.42243
sequence = AAACAAACAGGTGTTTAAAA

Gene: Sputw3181_1548: fatty oxidation complex, beta subunit
*
Shewanella sp ANA-3

Site:
position = -167
score = 5.42243
sequence = AAACAAACAGGTGTTTAAAA

Gene: Shewana3_1460: fatty oxidation complex, beta subunit
*
Shewanella sp MR-4

Site:
position = -167
score = 5.42243
sequence = AAACAAACAGGTGTTTAAAA

Gene: Shewmr4_1407: fatty oxidation complex, beta subunit
*
Shewanella sp MR-7

Site:
position = -167
score = 5.42243
sequence = AAACAAACAGGTGTTTAAAA

Gene: Shewmr7_1472: fatty oxidation complex, beta subunit
*
Shewanella baltica OS155

Site:
position = -168
score = 5.42243
sequence = AAACAAACAGGTGTTTAAAA

Gene: Sbal_2761: fatty oxidation complex, beta subunit
*
Shewanella denitrificans OS217

Site:
position = -141
score = 5.40734
sequence = AAATAAACGGGTGTTTAAAA

Gene: Sden_1529: fatty oxidation complex, beta subunit
*
Shewanella frigidimarina NCIMB 400

Site:
position = -136
score = 5.37965
sequence = TTGTAAACGCCTGTTTAAAA

Gene: Sfri_2677: fatty oxidation complex, beta subunit
*
Shewanella amazonensis SB2B

Site:
position = -144
score = 5.57794
sequence = ATGCAAACAAGTGTTTAAAA

Gene: Sama_2168: fatty oxidation complex, beta subunit
*
Shewanella loihica PV-4

Site:
position = -166
score = 5.42243
sequence = AACCAAACAGGTGTTTAAAA

Gene: Shew_2426: fatty oxidation complex, beta subunit
*
Shewanella pealeana ATCC 700345

Site:
position = -148
score = 5.35843
sequence = AAACAAACAAGTGTTTAAAA

Gene: Spea_2599: fatty oxidation complex, beta subunit
*
Shewanella halifaxensis HAW-EB4

Site:
position = -151
score = 5.35843
sequence = AAACAAACAAGTGTTTAAAA

Gene: Shal_2671: fatty oxidation complex, beta subunit
*
Shewanella piezotolerans WP3

Site:
position = -154
score = 5.35843
sequence = AAACAAACAAGTGTTTAAAA

Gene: swp_3140: fatty oxidation complex, beta subunit
*
Shewanella sediminis HAW-EB3

Site:
position = -183
score = 5.37727
sequence = AACCAAACAACTGTTTAAAA

Gene: Ssed_1628: fatty oxidation complex, beta subunit
*
Shewanella woodyi ATCC 51908

Site:
position = -170
score = 5.35843
sequence = AACCAAACAAGTGTTTAAAA

Gene: Swoo_3027: fatty oxidation complex, beta subunit
fatty oxidation complex, beta subunit
fadJ
 
Shewanella oneidensis MR-1

Gene: SO_3088: fatty oxidation complex, alpha subunit
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2459: fatty oxidation complex, alpha subunit
 
Shewanella sp W3-18-1

Gene: Sputw3181_1549: fatty oxidation complex, alpha subunit
 
Shewanella sp ANA-3

Gene: Shewana3_1461: fatty oxidation complex, alpha subunit
 
Shewanella sp MR-4

Gene: Shewmr4_1408: fatty oxidation complex, alpha subunit
 
Shewanella sp MR-7

Gene: Shewmr7_1473: fatty oxidation complex, alpha subunit
 
Shewanella baltica OS155

Gene: Sbal_2760: fatty oxidation complex, alpha subunit
 
Shewanella denitrificans OS217

Gene: Sden_1530: fatty oxidation complex, alpha subunit
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2676: fatty oxidation complex, alpha subunit
 
Shewanella amazonensis SB2B

Gene: Sama_2167: fatty oxidation complex, alpha subunit
 
Shewanella loihica PV-4

Gene: Shew_2425: fatty oxidation complex, alpha subunit
 
Shewanella pealeana ATCC 700345

Gene: Spea_2598: fatty oxidation complex, alpha subunit
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2670: fatty oxidation complex, alpha subunit
 
Shewanella piezotolerans WP3

Gene: swp_3139: fatty oxidation complex, alpha subunit
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1629: fatty oxidation complex, alpha subunit
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3026: fatty oxidation complex, alpha subunit
fatty oxidation complex, alpha subunit
 
CRON 20.
fadB
*
Shewanella oneidensis MR-1

Site:
position = -162
score = 6.06896
sequence = AATTAAACAGTCGTTTAAAT

Gene: SO_0021: fatty oxidation complex, alpha subunit
*
Shewanella putrefaciens CN-32

Site:
position = -162
score = 6.06896
sequence = AATTAAACAGTCGTTTAAAT

Gene: Sputcn32_0013: fatty oxidation complex, alpha subunit
*
Shewanella sp W3-18-1

Site:
position = -162
score = 6.06896
sequence = AATTAAACAGTCGTTTAAAT

Gene: Sputw3181_0013: fatty oxidation complex, alpha subunit
*
Shewanella sp ANA-3

Site:
position = -162
score = 6.06896
sequence = AATTAAACAGTCGTTTAAAT

Gene: Shewana3_0024: fatty oxidation complex, alpha subunit
*
Shewanella sp MR-4

Site:
position = -162
score = 6.06896
sequence = AATTAAACAGTCGTTTAAAT

Gene: Shewmr4_0018: fatty oxidation complex, alpha subunit
*
Shewanella sp MR-7

Site:
position = -162
score = 6.06896
sequence = AATTAAACAGTCGTTTAAAT

Gene: Shewmr7_0016: fatty oxidation complex, alpha subunit
*
Shewanella baltica OS155

Site:
position = -162
score = 6.06896
sequence = AATTAAACAGTCGTTTAAAT

Gene: Sbal_0021: fatty oxidation complex, alpha subunit
*
Shewanella denitrificans OS217

Site:
position = -149
score = 6.08535
sequence = AATTAAACGGCCGTTTAAAT

Gene: Sden_0015: fatty oxidation complex, alpha subunit
*
Shewanella frigidimarina NCIMB 400

Site:
position = -161
score = 6.08535
sequence = AATTAAACGGCCGTTTAAAT

Gene: Sfri_0013: fatty oxidation complex, alpha subunit
*
Shewanella amazonensis SB2B

Site:
position = -145
score = 5.88486
sequence = AATTAAACGATCGTTTTAAT

Gene: Sama_0032: fatty oxidation complex, alpha subunit
*
Shewanella loihica PV-4

Site:
position = -161
score = 6.09772
sequence = AATTAAACAAGTGTTTAAAT

Gene: Shew_0019: fatty oxidation complex, alpha subunit
*
Shewanella pealeana ATCC 700345

Site:
position = -168
score = 5.56178
sequence = AACTAAACGGTCGTTTAAAT

Gene: Spea_0018: fatty oxidation complex, alpha subunit
*
Shewanella halifaxensis HAW-EB4

Site:
position = -168
score = 5.52926
sequence = AACCAAACGACCGTTTAAAT

Gene: Shal_0016: fatty oxidation complex, alpha subunit
*
Shewanella piezotolerans WP3

Site:
position = -161
score = 5.53115
sequence = ATTCGAACACTCGTTTAAAT

Gene: swp_0035: fatty oxidation complex, alpha subunit
*
Shewanella sediminis HAW-EB3

Site:
position = -228
score = 6.08159
sequence = AATCAAACACCCGTTTAAAT

Gene: Ssed_0023: fatty oxidation complex, alpha subunit
*
Shewanella woodyi ATCC 51908

Site:
position = -166
score = 6.0652
sequence = AATCAAACAAGTGTTTAAAT

Gene: Swoo_0021: fatty oxidation complex, alpha subunit
fatty oxidation complex, alpha subunit
fadA
 
Shewanella oneidensis MR-1

Gene: SO_0020: fatty oxidation complex, beta subunit
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_0012: fatty oxidation complex, beta subunit
 
Shewanella sp W3-18-1

Gene: Sputw3181_0012: fatty oxidation complex, beta subunit
 
Shewanella sp ANA-3

Gene: Shewana3_0023: fatty oxidation complex, beta subunit
 
Shewanella sp MR-4

Gene: Shewmr4_0017: fatty oxidation complex, beta subunit
 
Shewanella sp MR-7

Gene: Shewmr7_0015: fatty oxidation complex, beta subunit
 
Shewanella baltica OS155

Gene: Sbal_0020: fatty oxidation complex, beta subunit
 
Shewanella denitrificans OS217

Gene: Sden_0014: fatty oxidation complex, beta subunit
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0012: fatty oxidation complex, beta subunit
 
Shewanella amazonensis SB2B

Gene: Sama_0031: fatty oxidation complex, beta subunit
 
Shewanella loihica PV-4

Gene: Shew_0018: fatty oxidation complex, beta subunit
 
Shewanella pealeana ATCC 700345

Gene: Spea_0017: fatty oxidation complex, beta subunit
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_0015: fatty oxidation complex, beta subunit
 
Shewanella piezotolerans WP3

Gene: swp_0034: fatty oxidation complex, beta subunit
 
Shewanella sediminis HAW-EB3

Gene: Ssed_0022: fatty oxidation complex, beta subunit
 
Shewanella woodyi ATCC 51908

Gene: Swoo_0020: fatty oxidation complex, beta subunit
fatty oxidation complex, beta subunit
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD