Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HutC - Nocardiaceae

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Histidine utilization
Effector: cis-Urocanic acid
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 12 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Nocardia farcinica IFM 10152 11 5
Rhodococcus erythropolis PR4 9 3
Rhodococcus opacus B4 6 2
Rhodococcus sp. RHA1 6 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
fadE15
*
Nocardia farcinica IFM 10152

Site:
position = -175
score = 6.17151
sequence = AAGCCTGTCTATACAGGAAT

Gene: nfa12300: Butyryl-CoA dehydrogenase (EC 1.3.99.2)
*
Rhodococcus erythropolis PR4

Site:
position = -174
score = 5.19119
sequence = CAACTTGTCTATACAGGTTT

Gene: RER_51260: Butyryl-CoA dehydrogenase (EC 1.3.99.2)
 
Rhodococcus opacus B4

Gene: ROP_47330: Butyryl-CoA dehydrogenase (EC 1.3.99.2)
 
Rhodococcus sp. RHA1

Gene: RHA1_ro04636: Butyryl-CoA dehydrogenase (EC 1.3.99.2)
Butyryl-CoA dehydrogenase (EC 1.3.99.2)
nfa12310
 
Nocardia farcinica IFM 10152

Gene: nfa12310: CAIB/BAIF family protein
 
Rhodococcus erythropolis PR4

Gene: RER_51270: CAIB/BAIF family protein
 
Rhodococcus opacus B4

Gene: ROP_47320: CAIB/BAIF family protein
 
Rhodococcus sp. RHA1

Gene: RHA1_ro04635: CAIB/BAIF family protein
CAIB/BAIF family protein
nfa12320
 
Nocardia farcinica IFM 10152

Gene: nfa12320: Transcriptional regulator, IclR family
 
Rhodococcus erythropolis PR4

Gene: RER_51280: Transcriptional regulator, IclR family
 
Rhodococcus opacus B4

Gene: ROP_47310: Transcriptional regulator, IclR family
 
Rhodococcus sp. RHA1

Gene: RHA1_ro04634: Transcriptional regulator, IclR family
Transcriptional regulator, IclR family
 
CRON 2.
gdh
*
Nocardia farcinica IFM 10152

Site:
position = -131
score = 5.87909
sequence = AGTCCTGTATATACAAGCAA

Gene: nfa12260: NAD-specific glutamate dehydrogenase (EC 1.4.1.2), large form
*
Rhodococcus erythropolis PR4

Site:
position = 67
score = 5.19119
sequence = AAACCTGTATAGACAAGTTG

Gene: RER_51250: NAD-specific glutamate dehydrogenase (EC 1.4.1.2), large form
*
Rhodococcus opacus B4

Site:
position = -90
score = 4.69454
sequence = AGTCCTGTATAGACAACCCC

Gene: ROP_47410: NAD-specific glutamate dehydrogenase (EC 1.4.1.2), large form
*
Rhodococcus sp. RHA1

Site:
position = -90
score = 4.69454
sequence = AGTCCTGTATAGACAACCCC

Gene: RHA1_ro04644: NAD-specific glutamate dehydrogenase (EC 1.4.1.2), large form
NAD-specific glutamate dehydrogenase (EC 1.4.1.2), large form
hutC
 
Nocardia farcinica IFM 10152

Gene: nfa12250: Histidine utilization repressor, GntR family
 
Rhodococcus erythropolis PR4

Gene: RER_51240: Histidine utilization repressor, GntR family
 
Rhodococcus opacus B4

Gene: ROP_47420: Histidine utilization repressor, GntR family
 
Rhodococcus sp. RHA1

Gene: RHA1_ro04645: Histidine utilization repressor, GntR family
Histidine utilization repressor, GntR family
 
CRON 3.
COG1457
*
Nocardia farcinica IFM 10152

Site:
position = -99
score = 5.89491
sequence = CAGCCTGTCTATACAGGCAT

Gene: nfa12330: Predicted histidine transporter, Purine-cytosine permease family
*
Rhodococcus erythropolis PR4

Site:
position = -151
score = 6.06761
sequence = ACGCCTGTATATACAGGCAT

Gene: RER_51330: Predicted histidine transporter, Purine-cytosine permease family
*
Rhodococcus opacus B4

Site:
position = -134
score = 4.69454
sequence = GGGGTTGTCTATACAGGACT

Gene: ROP_47400: Predicted histidine transporter, Purine-cytosine permease family
*
Rhodococcus sp. RHA1

Site:
position = -136
score = 4.69454
sequence = GGGGTTGTCTATACAGGACT

Gene: RHA1_ro04643: Predicted histidine transporter, Purine-cytosine permease family
Predicted histidine transporter, Purine-cytosine permease family
hutU
*
Nocardia farcinica IFM 10152

Site:
position = -81
score = 5.87909
sequence = TTGCTTGTATATACAGGACT

Gene: nfa12270: Urocanate hydratase (EC 4.2.1.49)
 
Rhodococcus erythropolis PR4

Gene: RER_51340: Urocanate hydratase (EC 4.2.1.49)
 
Rhodococcus opacus B4

Gene: ROP_47390: Urocanate hydratase (EC 4.2.1.49)
 
Rhodococcus sp. RHA1

Gene: RHA1_ro04642: Urocanate hydratase (EC 4.2.1.49)
Urocanate hydratase (EC 4.2.1.49)
hutI
 
Nocardia farcinica IFM 10152

Gene: nfa12340: Imidazolonepropionase (EC 3.5.2.7)
 
Rhodococcus erythropolis PR4

Gene: RER_51350: Imidazolonepropionase (EC 3.5.2.7)
 
Rhodococcus opacus B4

Gene: ROP_47380: Imidazolonepropionase (EC 3.5.2.7)
 
Rhodococcus sp. RHA1

Gene: RHA1_ro04641: Imidazolonepropionase (EC 3.5.2.7)
Imidazolonepropionase (EC 3.5.2.7)
hutG
 
Nocardia farcinica IFM 10152

Gene: nfa12350: Formiminoglutamase (EC 3.5.3.8)
 
Rhodococcus erythropolis PR4

Gene: RER_51360: Formiminoglutamase (EC 3.5.3.8)
 
Rhodococcus opacus B4

Gene: ROP_47370: Formiminoglutamase (EC 3.5.3.8)
 
Rhodococcus sp. RHA1

Gene: RHA1_ro04640: Formiminoglutamase (EC 3.5.3.8)
Formiminoglutamase (EC 3.5.3.8)
 
CRON 4.
COG1113
*
Nocardia farcinica IFM 10152

Site:
position = -107
score = 6.17151
sequence = ATTCCTGTATAGACAGGCTT

Gene: nfa12290: Predicted histidine transporter, Gamma-aminobutyrate permease family
 
Rhodococcus erythropolis PR4

Gene: RER_15210: Predicted histidine transporter, Gamma-aminobutyrate permease family
 
Rhodococcus opacus B4
 
Rhodococcus sp. RHA1
Predicted histidine transporter, Gamma-aminobutyrate permease family
hutH
 
Nocardia farcinica IFM 10152

Gene: nfa12280: Histidine ammonia-lyase (EC 4.3.1.3)
 
Rhodococcus erythropolis PR4

Gene: RER_51300: Histidine ammonia-lyase (EC 4.3.1.3)
 
Rhodococcus opacus B4

Gene: ROP_18710: Histidine ammonia-lyase (EC 4.3.1.3)
 
Rhodococcus sp. RHA1

Gene: RHA1_ro02154: Histidine ammonia-lyase (EC 4.3.1.3)
Histidine ammonia-lyase (EC 4.3.1.3)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD