Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CJA_0601 - Oceanospirillales/Alteromonadales

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Hypothetical ABC transporter
Effector:
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 1 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Alcanivorax borkumensis SK2
Chromohalobacter salexigens DSM 3043
Hahella chejuensis KCTC 2396
Marinomonas sp. MWYL1
Oceanobacter sp. RED65
Oceanospirillum sp. MED92
Reinekea sp. MED297
Marinobacter sp. ELB17
Marinobacter aqueolei
Saccharophagus degradans 2-40
Teredinibacter turnerae T7901
Cellvibrio japonicus Ueda107 7 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
HCH_01828
 
Alcanivorax borkumensis SK2
 
Chromohalobacter salexigens DSM 3043
 
Hahella chejuensis KCTC 2396

Gene: HCH_01828: GumN family protein
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_1567: GumN family protein
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92

Gene: MED92_13753: GumN family protein
 
Reinekea sp. MED297

Gene: MED297_06019: GumN family protein
 
Marinobacter sp. ELB17
 
Marinobacter aqueolei
 
Saccharophagus degradans 2-40

Gene: Sde_0615: GumN family protein
 
Teredinibacter turnerae T7901

Gene: TERTU_4341: GumN family protein
*
Cellvibrio japonicus Ueda107

Site:
position = -61
score = 6.05194
sequence = TGTGTATTAGTGTATTGATACACG

Gene: CJA_0598: GumN family protein
GumN family protein
CJA_0599
 
Alcanivorax borkumensis SK2
 
Chromohalobacter salexigens DSM 3043
 
Hahella chejuensis KCTC 2396
 
Marinomonas sp. MWYL1
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Reinekea sp. MED297
 
Marinobacter sp. ELB17
 
Marinobacter aqueolei
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107

Gene: CJA_0599: ABC transporter, ATP-binding protein
ABC transporter, ATP-binding protein
CJA_0600
 
Alcanivorax borkumensis SK2
 
Chromohalobacter salexigens DSM 3043
 
Hahella chejuensis KCTC 2396
 
Marinomonas sp. MWYL1
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Reinekea sp. MED297
 
Marinobacter sp. ELB17
 
Marinobacter aqueolei
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107

Gene: CJA_0600: putative membrane protein
putative membrane protein
CJA_0601
 
Alcanivorax borkumensis SK2
 
Chromohalobacter salexigens DSM 3043
 
Hahella chejuensis KCTC 2396
 
Marinomonas sp. MWYL1
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Reinekea sp. MED297
 
Marinobacter sp. ELB17
 
Marinobacter aqueolei
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107

Gene: CJA_0601: Transcriptional regulator, GntR family
Transcriptional regulator, GntR family
PF0561
 
Alcanivorax borkumensis SK2
 
Chromohalobacter salexigens DSM 3043
 
Hahella chejuensis KCTC 2396
 
Marinomonas sp. MWYL1
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Reinekea sp. MED297
 
Marinobacter sp. ELB17
 
Marinobacter aqueolei
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901

Gene: TERTU_3183: Hydrolase, alpha/beta hydrolase fold family
 
Cellvibrio japonicus Ueda107

Gene: CJA_0602: Hydrolase, alpha/beta hydrolase fold family
Hydrolase, alpha/beta hydrolase fold family
COG4555
 
Alcanivorax borkumensis SK2
 
Chromohalobacter salexigens DSM 3043
 
Hahella chejuensis KCTC 2396
 
Marinomonas sp. MWYL1
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Reinekea sp. MED297
 
Marinobacter sp. ELB17
 
Marinobacter aqueolei
 
Saccharophagus degradans 2-40

Gene: Sde_3736: Putative ABC-type Na+ transport system, ATPase component
 
Teredinibacter turnerae T7901

Gene: TERTU_3182: Putative ABC-type Na+ transport system, ATPase component
 
Cellvibrio japonicus Ueda107

Gene: CJA_0603: Putative ABC-type Na+ transport system, ATPase component
Putative ABC-type Na+ transport system, ATPase component
COG1668
 
Alcanivorax borkumensis SK2
 
Chromohalobacter salexigens DSM 3043
 
Hahella chejuensis KCTC 2396
 
Marinomonas sp. MWYL1
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Reinekea sp. MED297
 
Marinobacter sp. ELB17
 
Marinobacter aqueolei
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901

Gene: TERTU_3181: Predicted ABC-type Na+ efflux pump, permease component
 
Cellvibrio japonicus Ueda107

Gene: CJA_0604: Predicted ABC-type Na+ efflux pump, permease component
Predicted ABC-type Na+ efflux pump, permease component
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD