Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog NsrR - Shewanellaceae

Properties
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Nitrosative stress response
Effector: Nitric oxide
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 51 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Shewanella oneidensis MR-1 4 3
Shewanella putrefaciens CN-32 3 2
Shewanella sp W3-18-1 3 2
Shewanella sp ANA-3 7 5
Shewanella sp MR-4 5 4
Shewanella sp MR-7 5 4
Shewanella baltica OS155 5 4
Shewanella denitrificans OS217 1 1
Shewanella frigidimarina NCIMB 400 6 4
Shewanella amazonensis SB2B 4 3
Shewanella loihica PV-4 3 2
Shewanella pealeana ATCC 700345 5 3
Shewanella halifaxensis HAW-EB4 2 1
Shewanella piezotolerans WP3 5 3
Shewanella sediminis HAW-EB3 6 4
Shewanella woodyi ATCC 51908 5 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
nnrS2
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_3603: NnrS protein involved in response to NO
 
Shewanella sp W3-18-1

Gene: Sputw3181_3742: NnrS protein involved in response to NO
*
Shewanella sp ANA-3

Site:
position = -46
score = 4.52546
sequence = AAGTGCAATTATTATGAAGCT

Gene: Shewana3_2362: NnrS protein involved in response to NO
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
*
Shewanella denitrificans OS217

Site:
position = -110
score = 4.37171
sequence = ACAatCATtaTAaATaCcTGT

Gene: Sden_2837: NnrS protein involved in response to NO
*
Shewanella frigidimarina NCIMB 400

Site:
position = -64
score = 5.56222
sequence = AGATTTATATATTATGCATGT

Gene: Sfri_3037: NnrS protein involved in response to NO
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4

Gene: Shew_0504: NnrS protein involved in response to NO
*
Shewanella pealeana ATCC 700345

Site:
position = -35
score = 4.75461
sequence = AGCTGTATTTTAAATGCGTGT

Gene: Spea_1227: NnrS protein involved in response to NO
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_1261: NnrS protein involved in response to NO
*
Shewanella piezotolerans WP3

Site:
position = -39
score = 4.22593
sequence = AggTaCATtaAAaATaCcTGT

Gene: swp_3404: NnrS protein involved in response to NO
 
Shewanella sediminis HAW-EB3

Gene: Ssed_0687: NnrS protein involved in response to NO
 
Shewanella woodyi ATCC 51908
NnrS protein involved in response to NO
nrfA
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_3604: Nitrite reductase, cytochrome c(552)
 
Shewanella sp W3-18-1

Gene: Sputw3181_3743: Nitrite reductase, cytochrome c(552)
 
Shewanella sp ANA-3

Gene: Shewana3_2363: Nitrite reductase, cytochrome c(552)
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_3036: Nitrite reductase, cytochrome c(552)
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4

Gene: Shew_0505: Nitrite reductase, cytochrome c(552)
 
Shewanella pealeana ATCC 700345

Gene: Spea_1228: Nitrite reductase, cytochrome c(552)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_1262: Nitrite reductase, cytochrome c(552)
 
Shewanella piezotolerans WP3

Gene: swp_3403: Nitrite reductase, cytochrome c(552)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_0688: Nitrite reductase, cytochrome c(552)
 
Shewanella woodyi ATCC 51908
Nitrite reductase, cytochrome c(552)
 
CRON 2.
Ssed_4366
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_1091: hydroxylamine oxidoreductase
 
Shewanella piezotolerans WP3
*
Shewanella sediminis HAW-EB3

Site:
position = -169
score = 5.0032
sequence = ACATGCAAAATCAATACAGGT

Gene: Ssed_4366: hydroxylamine oxidoreductase
*
Shewanella woodyi ATCC 51908

Site:
position = -139
score = 5.04606
sequence = ACATGCGAAAAATATACAGGT

Gene: Swoo_4755: hydroxylamine oxidoreductase
hydroxylamine oxidoreductase
Ssed_4367
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_1092: NapC/NirT cytochrome c domain protein
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3

Gene: Ssed_4367: NapC/NirT cytochrome c domain protein
 
Shewanella woodyi ATCC 51908

Gene: Swoo_4756: NapC/NirT cytochrome c domain protein
NapC/NirT cytochrome c domain protein
 
CRON 3.
hmp
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
*
Shewanella sp ANA-3

Site:
position = -33
score = 5.56015
sequence = ACATTCATAAATAAAGCATGT

Gene: Shewana3_3174: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)
*
Shewanella sp MR-4

Site:
position = -67
score = 4.35195
sequence = TGATCCAAATCAAATGAATCT

Site:
position = -33
score = 4.68107
sequence = ACATTCATAAATAAGGCGTGT

Gene: Shewmr4_2996: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)
*
Shewanella sp MR-7

Site:
position = -67
score = 4.35195
sequence = TGATCCAAATCAAATGAATCT

Site:
position = -33
score = 5.76688
sequence = ACATTCATAAATAATGCATGT

Gene: Shewmr7_3077: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)
*
Shewanella baltica OS155

Site:
position = -33
score = 5.30822
sequence = ACATTCATAATATTTACACGT

Gene: Sbal_1014: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)
 
Shewanella denitrificans OS217
*
Shewanella frigidimarina NCIMB 400

Site:
position = -125
score = 4.82051
sequence = ACCTTTATATAATTTATATGT

Gene: Sfri_3699: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3

Gene: swp_4285: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908

Gene: Swoo_0685: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)
Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)
 
CRON 4.
nnrS
*
Shewanella oneidensis MR-1

Site:
position = -59
score = 5.36731
sequence = ACATTCATTTAATTTGCAGCT

Gene: SO_2805: NnrS protein involved in response to NO
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
*
Shewanella sp ANA-3

Site:
position = -58
score = 5.36731
sequence = ACATTCATTTTATTTGCAGCT

Gene: Shewana3_2587: NnrS protein involved in response to NO
*
Shewanella sp MR-4

Site:
position = -58
score = 5.36731
sequence = ACATTCATTTTATTTGCAGCT

Gene: Shewmr4_2425: NnrS protein involved in response to NO
*
Shewanella sp MR-7

Site:
position = -58
score = 5.36731
sequence = ACATTCATTTTATTTGCAGCT

Gene: Shewmr7_2495: NnrS protein involved in response to NO
*
Shewanella baltica OS155

Site:
position = -63
score = 5.26116
sequence = ACATTCATTTTAATTGCAGCT

Gene: Sbal_1680: NnrS protein involved in response to NO
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
*
Shewanella amazonensis SB2B

Site:
position = -59
score = 5.39056
sequence = ACATGCATATTTTAAGCACCT

Gene: Sama_1288: NnrS protein involved in response to NO
*
Shewanella loihica PV-4

Site:
position = -64
score = 5.24358
sequence = ACATGCATATAAATTACACCT

Gene: Shew_2322: NnrS protein involved in response to NO
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
*
Shewanella sediminis HAW-EB3

Site:
position = -13
score = 4.48067
sequence = ACTTGCATCTTAAATGCACCT

Gene: Ssed_2876: NnrS protein involved in response to NO
 
Shewanella woodyi ATCC 51908
NnrS protein involved in response to NO
 
CRON 5.
dnrN
*
Shewanella oneidensis MR-1

Site:
position = -126
score = 5.63847
sequence = AGCTGCAAATAATATGCATGT

Gene: SO_4302: Nitric oxide-dependent regulator DnrN or NorA
*
Shewanella putrefaciens CN-32

Site:
position = -49
score = 5.47346
sequence = AGCTGCAAATAATATGAATGT

Gene: Sputcn32_3576: Nitric oxide-dependent regulator DnrN or NorA
*
Shewanella sp W3-18-1

Site:
position = -49
score = 5.47346
sequence = AGCTGCAAATAATATGAATGT

Gene: Sputw3181_3715: Nitric oxide-dependent regulator DnrN or NorA
*
Shewanella sp ANA-3

Site:
position = -49
score = 5.62575
sequence = AGCTGCAAATATTATGCATGT

Gene: Shewana3_0397: Nitric oxide-dependent regulator DnrN or NorA
*
Shewanella sp MR-4

Site:
position = -49
score = 5.62575
sequence = AGCTGCAAATATTATGCATGT

Gene: Shewmr4_0398: Nitric oxide-dependent regulator DnrN or NorA
*
Shewanella sp MR-7

Site:
position = -49
score = 5.62575
sequence = AGCTGCAAATATTATGCATGT

Gene: Shewmr7_3627: Nitric oxide-dependent regulator DnrN or NorA
*
Shewanella baltica OS155

Site:
position = -48
score = 5.68929
sequence = AGATGCAAATAATATGAATGT

Gene: Sbal_3989: Nitric oxide-dependent regulator DnrN or NorA
 
Shewanella denitrificans OS217
*
Shewanella frigidimarina NCIMB 400

Site:
position = -26
score = 5.24766
sequence = AGATGCACATAAAATACATGT

Gene: Sfri_0450: Nitric oxide-dependent regulator DnrN or NorA
*
Shewanella amazonensis SB2B

Site:
position = -34
score = 4.60171
sequence = ACATGCATACAGATTGCAGCT

Gene: Sama_3236: Nitric oxide-dependent regulator DnrN or NorA
 
Shewanella loihica PV-4

Gene: Shew_0328: Nitric oxide-dependent regulator DnrN or NorA
*
Shewanella pealeana ATCC 700345

Site:
position = -60
score = 5.8543
sequence = AGATGCAAATAATATGCATGT

Gene: Spea_0383: Nitric oxide-dependent regulator DnrN or NorA
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_3908: Nitric oxide-dependent regulator DnrN or NorA
*
Shewanella piezotolerans WP3

Site:
position = -46
score = 5.10978
sequence = AGATGCAAATAATATACTTGT

Gene: swp_0412: Nitric oxide-dependent regulator DnrN or NorA
*
Shewanella sediminis HAW-EB3

Site:
position = -32
score = 4.82744
sequence = AGATATAAATAATTTGCAGCT

Gene: Ssed_4124: Nitric oxide-dependent regulator DnrN or NorA
*
Shewanella woodyi ATCC 51908

Site:
position = -33
score = 4.86029
sequence = ACATGCAAATACAAAGCAGCT

Gene: Swoo_0492: Nitric oxide-dependent regulator DnrN or NorA
Nitric oxide-dependent regulator DnrN or NorA
 
CRON 6.
hcp
*
Shewanella oneidensis MR-1

Site:
position = -42
score = 5.23703
sequence = ACATGTAAAAATAAAGCATGA

Gene: SO_1363: Hydroxylamine reductase (EC 1.7.-.-)
*
Shewanella putrefaciens CN-32

Site:
position = -42
score = 5.4973
sequence = ACATGCATAAATAAAGCATGA

Gene: Sputcn32_1174: Hydroxylamine reductase (EC 1.7.-.-)
*
Shewanella sp W3-18-1

Site:
position = -42
score = 5.4973
sequence = ACATGCATAAATAAAGCATGA

Gene: Sputw3181_2990: Hydroxylamine reductase (EC 1.7.-.-)
*
Shewanella sp ANA-3

Site:
position = -42
score = 5.42434
sequence = ACATGCAAAAATAAAGCATGA

Gene: Shewana3_3011: Hydroxylamine reductase (EC 1.7.-.-)
*
Shewanella sp MR-4

Site:
position = -42
score = 5.42434
sequence = ACATGCAAAAATAAAGCATGA

Gene: Shewmr4_2832: Hydroxylamine reductase (EC 1.7.-.-)
*
Shewanella sp MR-7

Site:
position = -42
score = 5.42434
sequence = ACATGCAAAAATAAAGCATGA

Gene: Shewmr7_2914: Hydroxylamine reductase (EC 1.7.-.-)
*
Shewanella baltica OS155

Site:
position = -42
score = 5.23703
sequence = ACATGTAAAAATAAAGCATGA

Gene: Sbal_1216: Hydroxylamine reductase (EC 1.7.-.-)
 
Shewanella denitrificans OS217
*
Shewanella frigidimarina NCIMB 400

Site:
position = -43
score = 5.01171
sequence = ACATGTAAAACTTATACATGA

Gene: Sfri_3609: Hydroxylamine reductase (EC 1.7.-.-)
*
Shewanella amazonensis SB2B

Site:
position = -40
score = 5.4973
sequence = ACATGCATAAATAAAGCATGA

Site:
position = -83
score = 4.48464
sequence = TGCTGCTTTTTAAATGCAGCA

Gene: Sama_0895: Hydroxylamine reductase (EC 1.7.-.-)
*
Shewanella loihica PV-4

Site:
position = -41
score = 5.13253
sequence = ACGTGCAAATAAAAAGCATGA

Gene: Shew_1069: Hydroxylamine reductase (EC 1.7.-.-)
*
Shewanella pealeana ATCC 700345

Site:
position = -43
score = 5.57535
sequence = ACATGTAAATAATATGCATGA

Gene: Spea_1055: Hydroxylamine reductase (EC 1.7.-.-)
*
Shewanella halifaxensis HAW-EB4

Site:
position = -13
score = 5.57535
sequence = ACATGTAAATAATATGCATGA

Gene: Shal_1103: Hydroxylamine reductase (EC 1.7.-.-)
*
Shewanella piezotolerans WP3

Site:
position = 41
score = 5.8543
sequence = AGATGCAAATTATATGCATGT

Gene: swp_3762: Hydroxylamine reductase (EC 1.7.-.-)
*
Shewanella sediminis HAW-EB3

Site:
position = -42
score = 5.44979
sequence = ACATGCAAATAAAAAGCATGA

Gene: Ssed_1165: Hydroxylamine reductase (EC 1.7.-.-)
*
Shewanella woodyi ATCC 51908

Site:
position = -42
score = 5.44979
sequence = ACATGCAAATAAAAAGCATGA

Gene: Swoo_1260: Hydroxylamine reductase (EC 1.7.-.-)
Hydroxylamine reductase (EC 1.7.-.-)
hcr
 
Shewanella oneidensis MR-1

Gene: SO_1364: NADH oxidoreductase hcr (EC 1.-.-.-)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1175: NADH oxidoreductase hcr (EC 1.-.-.-)
 
Shewanella sp W3-18-1

Gene: Sputw3181_2989: NADH oxidoreductase hcr (EC 1.-.-.-)
 
Shewanella sp ANA-3

Gene: Shewana3_3010: NADH oxidoreductase hcr (EC 1.-.-.-)
 
Shewanella sp MR-4

Gene: Shewmr4_2831: NADH oxidoreductase hcr (EC 1.-.-.-)
 
Shewanella sp MR-7

Gene: Shewmr7_2913: NADH oxidoreductase hcr (EC 1.-.-.-)
 
Shewanella baltica OS155

Gene: Sbal_1217: NADH oxidoreductase hcr (EC 1.-.-.-)
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_3608: NADH oxidoreductase hcr (EC 1.-.-.-)
 
Shewanella amazonensis SB2B

Gene: Sama_0896: NADH oxidoreductase hcr (EC 1.-.-.-)
 
Shewanella loihica PV-4

Gene: Shew_1070: NADH oxidoreductase hcr (EC 1.-.-.-)
 
Shewanella pealeana ATCC 700345

Gene: Spea_1056: NADH oxidoreductase hcr (EC 1.-.-.-)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_1104: NADH oxidoreductase hcr (EC 1.-.-.-)
 
Shewanella piezotolerans WP3

Gene: swp_3761: NADH oxidoreductase hcr (EC 1.-.-.-)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1166: NADH oxidoreductase hcr (EC 1.-.-.-)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_1261: NADH oxidoreductase hcr (EC 1.-.-.-)
NADH oxidoreductase hcr (EC 1.-.-.-)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD