Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog NrtR - Shewanellaceae

Properties
Regulator type: Transcription factor
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Shewanella oneidensis MR-1 2 1
Shewanella putrefaciens CN-32 2 1
Shewanella sp W3-18-1 2 1
Shewanella sp ANA-3
Shewanella sp MR-4
Shewanella sp MR-7
Shewanella baltica OS155
Shewanella denitrificans OS217
Shewanella frigidimarina NCIMB 400
Shewanella amazonensis SB2B
Shewanella loihica PV-4
Shewanella pealeana ATCC 700345
Shewanella halifaxensis HAW-EB4
Shewanella piezotolerans WP3
Shewanella sediminis HAW-EB3
Shewanella woodyi ATCC 51908
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
prs
*
Shewanella oneidensis MR-1

Site:
position = -170
score = 6.93343
sequence = ATAGTGTCTAAAAGACACTAT

Site:
position = -84
score = 6.58032
sequence = ATAATGTCTTTAAGACACTAT

Gene: SO_1980: Ribose-phosphate pyrophosphokinase (EC 2.7.6.1)
*
Shewanella putrefaciens CN-32

Site:
position = -170
score = 6.71333
sequence = ATAGTGTCTAAAGGACACTAT

Site:
position = -84
score = 6.58032
sequence = ATAATGTCTTTAAGACACTAT

Gene: Sputcn32_2327: Ribose-phosphate pyrophosphokinase (EC 2.7.6.1)
*
Shewanella sp W3-18-1

Site:
position = -170
score = 6.71333
sequence = ATAGTGTCTAAAGGACACTAT

Site:
position = -84
score = 6.58032
sequence = ATAATGTCTTTAAGACACTAT

Gene: Sputw3181_1681: Ribose-phosphate pyrophosphokinase (EC 2.7.6.1)
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Ribose-phosphate pyrophosphokinase (EC 2.7.6.1)
nadV
 
Shewanella oneidensis MR-1

Gene: SO_1981: Nicotinamide phosphoribosyltransferase (EC 2.4.2.12)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2326: Nicotinamide phosphoribosyltransferase (EC 2.4.2.12)
 
Shewanella sp W3-18-1

Gene: Sputw3181_1682: Nicotinamide phosphoribosyltransferase (EC 2.4.2.12)
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Nicotinamide phosphoribosyltransferase (EC 2.4.2.12)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD