Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ArgR - Streptomycetaceae

Properties
Regulator type: Transcription factor
Regulator family: ArgR
Regulation mode: repressor (activator)
Biological process: Arginine biosynthesis
Effector: Arginine
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 29 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Streptomyces avermitilis MA-4680 10 5
Streptomyces coelicolor A3(2) 10 6
Streptomyces griseus subsp. griseus NBRC 13350 9 4
Streptomyces scabiei 87.22 8 4
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
argG
*2
Streptomyces avermitilis MA-4680

Site:
position = -36
score = 3.83321
sequence = TCATGCAGAGCCCTGCATAC

Site:
position = -26
score = 5.17327
sequence = CCCTGCATACTCATGCATGT

Gene: SAV_6778: Argininosuccinate synthase (EC 6.3.4.5)

Site:
position = -37
score = 4.612
sequence = CCTTGCATGAAAATGCGCGA

Gene: SAV_801: Argininosuccinate synthase (EC 6.3.4.5)
*
Streptomyces coelicolor A3(2)

Site:
position = -37
score = 5.33603
sequence = CTTTGCATGGTCATGCGTAA

Site:
position = -27
score = 4.30436
sequence = TCATGCGTAATGATGCATAC

Gene: SCO7036: Argininosuccinate synthase (EC 6.3.4.5)
*2
Streptomyces griseus subsp. griseus NBRC 13350

Site:
position = -27
score = 5.06639
sequence = TCATGCATAAGAATGCATAC

Site:
position = -37
score = 5.3195
sequence = TGTTGCATGATCATGCATAA

Gene: SGR_3668: Argininosuccinate synthase (EC 6.3.4.5)

Site:
position = -47
score = 4.39924
sequence = GACTGCATAGTTATACCCAT

Gene: SGR_5966: Argininosuccinate synthase (EC 6.3.4.5)
*
Streptomyces scabiei 87.22

Site:
position = -37
score = 5.53739
sequence = CTTTGCATGATCATGCGTTG

Site:
position = -27
score = 3.74374
sequence = TCATGCGTTGGCGTGCATAA

Gene: SCAB_44121: Argininosuccinate synthase (EC 6.3.4.5)
Argininosuccinate synthase (EC 6.3.4.5)
argH
 
Streptomyces avermitilis MA-4680

Gene: SAV_6779: Argininosuccinate lyase (EC 4.3.2.1)
*
Streptomyces coelicolor A3(2)

Site:
position = -59
score = 3.87606
sequence = ACATGCAGAGTTCTGCATAC

Site:
position = -49
score = 5.27259
sequence = TTCTGCATACTCATGCATGA

Gene: SCO1570: Argininosuccinate lyase (EC 4.3.2.1)
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_5967: Argininosuccinate lyase (EC 4.3.2.1)
*
Streptomyces scabiei 87.22

Site:
position = -71
score = 3.97539
sequence = TCATGCAGAGTTCTGCATAC

Site:
position = -61
score = 5.27259
sequence = TTCTGCATACTCATGCATGA

Gene: SCAB_74301: Argininosuccinate lyase (EC 4.3.2.1)
Argininosuccinate lyase (EC 4.3.2.1)
 
CRON 2.
SCO1086
*
Streptomyces avermitilis MA-4680

Site:
position = -44
score = 4.55262
sequence = CGATGCATAGATATGCGATC

Gene: SAV_1487: Putative transglutaminase
*
Streptomyces coelicolor A3(2)

Site:
position = -44
score = 4.89149
sequence = CACTGCATAGGTATGCGTTC

Gene: SCO1086: Putative transglutaminase
*
Streptomyces griseus subsp. griseus NBRC 13350

Site:
position = -70
score = 4.49248
sequence = TCGCGCATAACCATGCGACC

Gene: SGR_6519: Putative transglutaminase
*
Streptomyces scabiei 87.22

Site:
position = -71
score = 4.23073
sequence = GACTGCATAGATATACGGTC

Gene: SCAB_82621: Putative transglutaminase
Putative transglutaminase
 
CRON 3.
argC
*
Streptomyces avermitilis MA-4680

Site:
position = -55
score = 4.22732
sequence = GATTGCATAAACGTGCAGCG

Site:
position = -35
score = 4.58836
sequence = AAACGTATAGTCATGCCATC

Gene: SAV_6763: N-acetyl-gamma-glutamyl-phosphate reductase (EC 1.2.1.38)
*
Streptomyces coelicolor A3(2)

Site:
position = -57
score = 4.47812
sequence = CATTGCATAAACGTGCATCG

Site:
position = -37
score = 4.07816
sequence = GCACGTATAGTCATGCTCTC

Gene: SCO1580: N-acetyl-gamma-glutamyl-phosphate reductase (EC 1.2.1.38)
*2
Streptomyces griseus subsp. griseus NBRC 13350

Site:
position = -57
score = 3.79471
sequence = CTTTGCATAAAAGTGCGCCG

Site:
position = -37
score = 4.49862
sequence = CTGCGTATAGTCATGCCATC

Gene: SGR_5960: N-acetyl-gamma-glutamyl-phosphate reductase (EC 1.2.1.38)

Gene: SGR_3479: N-acetyl-gamma-glutamyl-phosphate reductase (EC 1.2.1.38)
*
Streptomyces scabiei 87.22

Site:
position = -35
score = 4.58836
sequence = AAACGTATAGTCATGCCATC

Site:
position = -55
score = 4.22732
sequence = GATTGCATAAACGTGCAGCG

Gene: SCAB_74201: N-acetyl-gamma-glutamyl-phosphate reductase (EC 1.2.1.38)
N-acetyl-gamma-glutamyl-phosphate reductase (EC 1.2.1.38)
argJ
 2
Streptomyces avermitilis MA-4680

Gene: SAV_6764: Glutamate N-acetyltransferase (EC 2.3.1.35) / N-acetylglutamate synthase (EC 2.3.1.1)

Gene: SAV_3684: Glutamate N-acetyltransferase (EC 2.3.1.35) / N-acetylglutamate synthase (EC 2.3.1.1)
 
Streptomyces coelicolor A3(2)

Gene: SCO1579: Glutamate N-acetyltransferase (EC 2.3.1.35) / N-acetylglutamate synthase (EC 2.3.1.1)
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_5961: Glutamate N-acetyltransferase (EC 2.3.1.35) / N-acetylglutamate synthase (EC 2.3.1.1)
 
Streptomyces scabiei 87.22

Gene: SCAB_74211: Glutamate N-acetyltransferase (EC 2.3.1.35) / N-acetylglutamate synthase (EC 2.3.1.1)
Glutamate N-acetyltransferase (EC 2.3.1.35) / N-acetylglutamate synthase (EC 2.3.1.1)
argB
 
Streptomyces avermitilis MA-4680

Gene: SAV_6765: Acetylglutamate kinase (EC 2.7.2.8)
 
Streptomyces coelicolor A3(2)

Gene: SCO1578: Acetylglutamate kinase (EC 2.7.2.8)
 2
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_5962: Acetylglutamate kinase (EC 2.7.2.8)

Gene: SGR_3480: Acetylglutamate kinase (EC 2.7.2.8)
 
Streptomyces scabiei 87.22

Gene: SCAB_74221: Acetylglutamate kinase (EC 2.7.2.8)
Acetylglutamate kinase (EC 2.7.2.8)
argD
 
Streptomyces avermitilis MA-4680

Gene: SAV_6766: Acetylornithine aminotransferase (EC 2.6.1.11)
 
Streptomyces coelicolor A3(2)

Gene: SCO1577: Acetylornithine aminotransferase (EC 2.6.1.11)
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_5963: Acetylornithine aminotransferase (EC 2.6.1.11)
 
Streptomyces scabiei 87.22

Gene: SCAB_74231: Acetylornithine aminotransferase (EC 2.6.1.11)
Acetylornithine aminotransferase (EC 2.6.1.11)
argR
 
Streptomyces avermitilis MA-4680

Gene: SAV_6767: Arginine metabolism transcriptional regulator ArgR, ArgR family
 
Streptomyces coelicolor A3(2)

Gene: SCO1576: Arginine metabolism transcriptional regulator ArgR, ArgR family
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_5964: Arginine metabolism transcriptional regulator ArgR, ArgR family
 
Streptomyces scabiei 87.22

Gene: SCAB_74241: Arginine metabolism transcriptional regulator ArgR, ArgR family
Arginine metabolism transcriptional regulator ArgR, ArgR family
 
CRON 4.
SCO2628
*
Streptomyces avermitilis MA-4680

Site:
position = -28
score = 3.92712
sequence = CAGTGCAAGATCCTGCAGGA

Gene: SAV_3165: Predicted transcriptional regulator, LuxR family
*
Streptomyces coelicolor A3(2)

Site:
position = -42
score = 5.11436
sequence = TGTGGCATGATCATGCATTG

Gene: SCO2686: Predicted transcriptional regulator, LuxR family
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_2482: Predicted transcriptional regulator, LuxR family
 
Streptomyces scabiei 87.22
Predicted transcriptional regulator, LuxR family
 
CRON 5.
cpdB
 
Streptomyces avermitilis MA-4680

Gene: SAV_6215: 2',3'-cyclic-nucleotide 2'-phosphodiesterase (EC 3.1.4.16)
*
Streptomyces coelicolor A3(2)

Site:
position = -178
score = 3.59679
sequence = CCACGCATGACCACTCAACA

Gene: SCO2015: 2',3'-cyclic-nucleotide 2'-phosphodiesterase (EC 3.1.4.16)
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_5514: 2',3'-cyclic-nucleotide 2'-phosphodiesterase (EC 3.1.4.16)
 
Streptomyces scabiei 87.22

Gene: SCAB_68841: 2',3'-cyclic-nucleotide 2'-phosphodiesterase (EC 3.1.4.16)
2',3'-cyclic-nucleotide 2'-phosphodiesterase (EC 3.1.4.16)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD