Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ModE - Shewanellaceae

Properties
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor
Biological process: Molybdopterin biosynthesis; Molybdenum homeostasis
Effector: Molybdate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 10 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Shewanella oneidensis MR-1 4 2
Shewanella putrefaciens CN-32
Shewanella sp W3-18-1
Shewanella sp ANA-3 4 2
Shewanella sp MR-4 4 2
Shewanella sp MR-7 4 2
Shewanella baltica OS155 4 2
Shewanella denitrificans OS217
Shewanella frigidimarina NCIMB 400
Shewanella amazonensis SB2B
Shewanella loihica PV-4
Shewanella pealeana ATCC 700345
Shewanella halifaxensis HAW-EB4
Shewanella piezotolerans WP3
Shewanella sediminis HAW-EB3
Shewanella woodyi ATCC 51908
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
modA2
*
Shewanella oneidensis MR-1

Site:
position = -73
score = 5.92034
sequence = CTCGATATATAGATTGGTATATATCGAT

Gene: SO_3863: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
*
Shewanella sp ANA-3

Site:
position = -52
score = 5.86161
sequence = ACCGATATATAGATTGGTATATAACGAT

Gene: Shewana3_0743: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
*
Shewanella sp MR-4

Site:
position = -52
score = 6.42934
sequence = ATCGATATATAGATTGGTATATAACGAT

Gene: Shewmr4_3195: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
*
Shewanella sp MR-7

Site:
position = -52
score = 6.42934
sequence = ATCGATATATAGATTGGTATATAACGAT

Gene: Shewmr7_0769: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
*
Shewanella baltica OS155

Site:
position = -52
score = 6.42934
sequence = ATCGATATATAGATTGGTATATAACGAT

Gene: Sbal_3538: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
modB2
 
Shewanella oneidensis MR-1

Gene: SO_3864: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3

Gene: Shewana3_0742: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Shewanella sp MR-4

Gene: Shewmr4_3196: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Shewanella sp MR-7

Gene: Shewmr7_0768: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Shewanella baltica OS155

Gene: Sbal_3539: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
modC2
 
Shewanella oneidensis MR-1

Gene: SO_3865: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3

Gene: Shewana3_0741: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Shewanella sp MR-4

Gene: Shewmr4_3197: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Shewanella sp MR-7

Gene: Shewmr7_0767: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Shewanella baltica OS155

Gene: Sbal_3540: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
CRON 2.
modE
*
Shewanella oneidensis MR-1

Site:
position = -178
score = 5.92034
sequence = ATCGATATATACCAATCTATATATCGAG

Gene: SO_3862: Molybdate-responsive transcriptional regulator ModE
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
*
Shewanella sp ANA-3

Site:
position = -178
score = 5.86161
sequence = ATCGTTATATACCAATCTATATATCGGT

Gene: Shewana3_0744: Molybdate-responsive transcriptional regulator ModE
*
Shewanella sp MR-4

Site:
position = -178
score = 6.42934
sequence = ATCGTTATATACCAATCTATATATCGAT

Gene: Shewmr4_3194: Molybdate-responsive transcriptional regulator ModE
*
Shewanella sp MR-7

Site:
position = -178
score = 6.42934
sequence = ATCGTTATATACCAATCTATATATCGAT

Gene: Shewmr7_0770: Molybdate-responsive transcriptional regulator ModE
*
Shewanella baltica OS155

Site:
position = -446
score = 6.42934
sequence = ATCGTTATATAccaAtcTATATAtCGAT

Gene: Sbal_3537: Molybdate-responsive transcriptional regulator ModE
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Molybdate-responsive transcriptional regulator ModE
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD