Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog LexA - Listeriaceae

Properties
Regulator type: Transcription factor
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 48 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Listeria innocua Clip11262 25 12
Listeria monocytogenes EGD-e 25 12
Listeria seeligeri serovar 1/2b str. SLCC3954 22 10
Listeria welshimeri serovar 6b str. SLCC5334 22 10
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
uvrB
*
Listeria innocua Clip11262

Site:
position = -163
score = 6.10283
sequence = GAATACGAAAATATGTTCGGTTTT

Gene: lin2632: Excinuclease ABC, subunit B
*
Listeria monocytogenes EGD-e

Site:
position = -165
score = 6.2522
sequence = AAATGCGAAAATATGTTCGGTTTT

Gene: lmo2489: Excinuclease ABC, subunit B
*
Listeria seeligeri serovar 1/2b str. SLCC3954

Site:
position = -165
score = 6.43366
sequence = AAATACGAAAATATGTTCGGTTTT

Gene: lse_2389: Excinuclease ABC, subunit B
*
Listeria welshimeri serovar 6b str. SLCC5334

Site:
position = -166
score = 6.43366
sequence = AAATACGAAAATATGTTCGGTTTT

Gene: lwe2437: Excinuclease ABC, subunit B
Excinuclease ABC, subunit B
uvrA
 
Listeria innocua Clip11262

Gene: lin2631: Excinuclease ABC, subunit A
 
Listeria monocytogenes EGD-e

Gene: lmo2488: Excinuclease ABC, subunit A
 
Listeria seeligeri serovar 1/2b str. SLCC3954

Gene: lse_2388: Excinuclease ABC, subunit A
 
Listeria welshimeri serovar 6b str. SLCC5334

Gene: lwe2436: Excinuclease ABC, subunit A
Excinuclease ABC, subunit A
 
CRON 2.
recA
*
Listeria innocua Clip11262

Site:
position = -142
score = 6.30014
sequence = AAATACGAATAAATGTTCGCTTTT

Gene: lin1435: DNA recombinase A
*
Listeria monocytogenes EGD-e

Site:
position = -142
score = 6.30014
sequence = AAATACGAATAAATGTTCGCTTTT

Gene: lmo1398: DNA recombinase A
*
Listeria seeligeri serovar 1/2b str. SLCC3954

Site:
position = -143
score = 6.30014
sequence = AAATACGAATAAATGTTCGCTTTT

Gene: lse_1315: DNA recombinase A
*
Listeria welshimeri serovar 6b str. SLCC5334

Site:
position = -143
score = 6.30014
sequence = AAATACGAATAAATGTTCGCTTTT

Gene: lwe1414: DNA recombinase A
DNA recombinase A
 
CRON 3.
lexA
*
Listeria innocua Clip11262

Site:
position = -144
score = 6.0385
sequence = AAAAAAGAATGTACGTTCGCTTTT

Site:
position = -84
score = 5.60417
sequence = AAAAACGAACCTTTGTTTGCATAT

Gene: lin1340: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Listeria monocytogenes EGD-e

Site:
position = -144
score = 5.91372
sequence = CAAAAAGAATGTATGTTCGCTTTT

Site:
position = -84
score = 5.60417
sequence = AAAAACGAACCTTTGTTTGCATAT

Gene: lmo1302: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Listeria seeligeri serovar 1/2b str. SLCC3954

Site:
position = -83
score = 5.60417
sequence = AAAAACGAACCTTTGTTTGCATAT

Site:
position = -142
score = 5.67401
sequence = CCAAAAGAATGTATGTTCGCTTTT

Gene: lse_1219: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Listeria welshimeri serovar 6b str. SLCC5334

Site:
position = -84
score = 5.60417
sequence = AAAAACGAACCTTTGTTTGCATAT

Site:
position = -146
score = 5.91372
sequence = CAAAAAGAATGTATGTTCGCTTTT

Gene: lwe1317: SOS-response repressor and protease LexA (EC 3.4.21.88)
SOS-response repressor and protease LexA (EC 3.4.21.88)
guaA
 
Listeria innocua Clip11262

Gene: lin1339: Probable GMP synthase
 
Listeria monocytogenes EGD-e

Gene: lmo1301: Probable GMP synthase
 
Listeria seeligeri serovar 1/2b str. SLCC3954

Gene: lse_1218: Probable GMP synthase
 
Listeria welshimeri serovar 6b str. SLCC5334

Gene: lwe1316: Probable GMP synthase
Probable GMP synthase
 
CRON 4.
yhaO
*
Listeria innocua Clip11262

Site:
position = -42
score = 5.89468
sequence = TAATAAGAACGTATATTCGGTTTT

Gene: lin2325: Predicted DNA double-strand break repair protein
*
Listeria monocytogenes EGD-e

Site:
position = -41
score = 5.89468
sequence = TAATAAGAACGTATATTCGGTTTT

Gene: lmo2222: Predicted DNA double-strand break repair protein
*
Listeria seeligeri serovar 1/2b str. SLCC3954

Site:
position = -44
score = 5.89468
sequence = TAATAAGAACGTATATTCGGTTTT

Gene: lse_2202: Predicted DNA double-strand break repair protein
*
Listeria welshimeri serovar 6b str. SLCC5334

Site:
position = -39
score = 5.89468
sequence = TAATAAGAACGTATATTCGGTTTT

Gene: lwe2239: Predicted DNA double-strand break repair protein
Predicted DNA double-strand break repair protein
yhaN
 
Listeria innocua Clip11262

Gene: lin2324: Putative DNA double-strand break repair ATPase
 
Listeria monocytogenes EGD-e

Gene: lmo2221: Putative DNA double-strand break repair ATPase
 
Listeria seeligeri serovar 1/2b str. SLCC3954

Gene: lse_2201: Putative DNA double-strand break repair ATPase
 
Listeria welshimeri serovar 6b str. SLCC5334

Gene: lwe2238: Putative DNA double-strand break repair ATPase
Putative DNA double-strand break repair ATPase
yhaM
 
Listeria innocua Clip11262

Gene: lin2323: Predicted 3'-5' exoribonuclease
 
Listeria monocytogenes EGD-e

Gene: lmo2220: Predicted 3'-5' exoribonuclease
 
Listeria seeligeri serovar 1/2b str. SLCC3954

Gene: lse_2200: Predicted 3'-5' exoribonuclease
 
Listeria welshimeri serovar 6b str. SLCC5334

Gene: lwe2237: Predicted 3'-5' exoribonuclease
Predicted 3'-5' exoribonuclease
 
CRON 5.
pcrA
*
Listeria innocua Clip11262

Site:
position = -44
score = 5.83983
sequence = AAATAAGAACAAATGTTTGTATGG

Gene: lin1871: ATP-dependent DNA helicase UvrD/PcrA
*
Listeria monocytogenes EGD-e

Site:
position = -44
score = 5.83983
sequence = AAATAAGAACAAATGTTTGTATGG

Gene: lmo1759: ATP-dependent DNA helicase UvrD/PcrA
*
Listeria seeligeri serovar 1/2b str. SLCC3954

Site:
position = -44
score = 5.83983
sequence = AAATAAGAACAAATGTTTGTATGG

Gene: lse_1731: ATP-dependent DNA helicase UvrD/PcrA
*
Listeria welshimeri serovar 6b str. SLCC5334

Site:
position = -38
score = 5.83983
sequence = AAATAAGAACAAATGTTTGTATGG

Gene: lwe1776: ATP-dependent DNA helicase UvrD/PcrA
ATP-dependent DNA helicase UvrD/PcrA
ligA
 
Listeria innocua Clip11262

Gene: lin1870: DNA ligase (EC 6.5.1.2)
 
Listeria monocytogenes EGD-e

Gene: lmo1758: DNA ligase (EC 6.5.1.2)
 
Listeria seeligeri serovar 1/2b str. SLCC3954

Gene: lse_1730: DNA ligase (EC 6.5.1.2)
 
Listeria welshimeri serovar 6b str. SLCC5334

Gene: lwe1775: DNA ligase (EC 6.5.1.2)
DNA ligase (EC 6.5.1.2)
yerH
 
Listeria innocua Clip11262

Gene: lin1869: Putative lipoprotein
 
Listeria monocytogenes EGD-e

Gene: lmo1757: Putative lipoprotein
 
Listeria seeligeri serovar 1/2b str. SLCC3954

Gene: lse_1729: Putative lipoprotein
 
Listeria welshimeri serovar 6b str. SLCC5334

Gene: lwe1774: Putative lipoprotein
Putative lipoprotein
 
CRON 6.
dnaE
*
Listeria innocua Clip11262

Site:
position = -75
score = 5.63719
sequence = AAACGCGAACACACTTTCTTTTTT

Gene: lin1609: DNA polymerase III alpha subunit (EC 2.7.7.7)
*
Listeria monocytogenes EGD-e

Site:
position = -75
score = 5.81865
sequence = AAACACGAACACACTTTCTTTTTT

Gene: lmo1574: DNA polymerase III alpha subunit (EC 2.7.7.7)
*
Listeria seeligeri serovar 1/2b str. SLCC3954

Site:
position = -75
score = 5.81865
sequence = AAACACGAACACACTTTCTTTTTT

Gene: lse_1489: DNA polymerase III alpha subunit (EC 2.7.7.7)
*
Listeria welshimeri serovar 6b str. SLCC5334

Site:
position = -75
score = 5.81865
sequence = AAACACGAACACACTTTCTTTTTT

Gene: lwe1587: DNA polymerase III alpha subunit (EC 2.7.7.7)
DNA polymerase III alpha subunit (EC 2.7.7.7)
 
CRON 7.
addB
*
Listeria innocua Clip11262

Site:
position = -30
score = 5.75957
sequence = AAATAAAAACATATGTTCGGTGGT

Gene: lin2369: ATP-dependent nuclease, subunit B
*
Listeria monocytogenes EGD-e

Site:
position = -30
score = 5.75957
sequence = AAATAAAAACATATGTTCGGTGGT

Gene: lmo2268: ATP-dependent nuclease, subunit B
*
Listeria seeligeri serovar 1/2b str. SLCC3954

Site:
position = -30
score = 5.60011
sequence = AAATAAAAACGTATGTTCGGTGGT

Gene: lse_2247: ATP-dependent nuclease, subunit B
*
Listeria welshimeri serovar 6b str. SLCC5334

Site:
position = -30
score = 5.75957
sequence = AAATAAAAACATATGTTCGGTGGT

Gene: lwe2283: ATP-dependent nuclease, subunit B
ATP-dependent nuclease, subunit B
addA
 
Listeria innocua Clip11262

Gene: lin2368: ATP-dependent nuclease, subunit A
 
Listeria monocytogenes EGD-e

Gene: lmo2267: ATP-dependent nuclease, subunit A
 
Listeria seeligeri serovar 1/2b str. SLCC3954

Gene: lse_2246: ATP-dependent nuclease, subunit A
 
Listeria welshimeri serovar 6b str. SLCC5334

Gene: lwe2282: ATP-dependent nuclease, subunit A
ATP-dependent nuclease, subunit A
yisK
 
Listeria innocua Clip11262

Gene: lin2367: Conserved hypothetical protein
 
Listeria monocytogenes EGD-e

Gene: lmo2266: Conserved hypothetical protein
 
Listeria seeligeri serovar 1/2b str. SLCC3954

Gene: lse_2245: Conserved hypothetical protein
 
Listeria welshimeri serovar 6b str. SLCC5334

Gene: lwe2281: Conserved hypothetical protein
Conserved hypothetical protein
PF07457
 
Listeria innocua Clip11262

Gene: lin2366: Conserved hypothetical protein
 
Listeria monocytogenes EGD-e

Gene: lmo2265: Conserved hypothetical protein
 
Listeria seeligeri serovar 1/2b str. SLCC3954

Gene: lse_2244: Conserved hypothetical protein
 
Listeria welshimeri serovar 6b str. SLCC5334

Gene: lwe2280: Conserved hypothetical protein
Conserved hypothetical protein
 
CRON 8.
lmo2675
*
Listeria innocua Clip11262

Site:
position = -73
score = 5.52472
sequence = AAACAAGAACGTTTGTTCGTATAA

Gene: lin2822: Conserved hypothetical protein
*
Listeria monocytogenes EGD-e

Site:
position = -72
score = 5.63547
sequence = TAATAAGAACATTTGTTCGTATAA

Gene: lmo2675: Conserved hypothetical protein
*
Listeria seeligeri serovar 1/2b str. SLCC3954

Site:
position = -72
score = 5.24049
sequence = CAACAAGAACATTCGTTCGTATAA

Gene: lse_2581: Conserved hypothetical protein
*
Listeria welshimeri serovar 6b str. SLCC5334

Site:
position = -72
score = 5.09735
sequence = AAAATAGAACGCTTGTTCGTATAA

Gene: lwe2624: Conserved hypothetical protein
Conserved hypothetical protein
uvrX
 
Listeria innocua Clip11262

Gene: lin2823: Predicted UV-damage repair protein UvrX
 
Listeria monocytogenes EGD-e

Gene: lmo2676: Predicted UV-damage repair protein UvrX
 
Listeria seeligeri serovar 1/2b str. SLCC3954

Gene: lse_2582: Predicted UV-damage repair protein UvrX
 
Listeria welshimeri serovar 6b str. SLCC5334

Gene: lwe2625: Predicted UV-damage repair protein UvrX
Predicted UV-damage repair protein UvrX
 
CRON 9.
dinP
*
Listeria innocua Clip11262

Site:
position = -38
score = 5.52928
sequence = GAATAAGAACGCTTGTTCGTTTTA

Gene: lin2082: DNA polymerase IV (EC 2.7.7.7)
*
Listeria monocytogenes EGD-e

Site:
position = -38
score = 5.5507
sequence = GAATAAGAACGCTTGTTCGTTTTG

Gene: lmo1975: DNA polymerase IV (EC 2.7.7.7)
*
Listeria seeligeri serovar 1/2b str. SLCC3954

Site:
position = -39
score = 5.51056
sequence = ATTAAGGAACATTTGTTCGTTTTT

Gene: lse_1955: DNA polymerase IV (EC 2.7.7.7)
*
Listeria welshimeri serovar 6b str. SLCC5334

Site:
position = -41
score = 5.25201
sequence = GATTAAGAACGTTTGTTCGATTTT

Gene: lwe1994: DNA polymerase IV (EC 2.7.7.7)
DNA polymerase IV (EC 2.7.7.7)
 
CRON 10.
srmB
*
Listeria innocua Clip11262

Site:
position = -57
score = 4.67387
sequence = TGATGCGAACGTAGGTTCTGTGTT

Gene: lin0195: DinG family ATP-dependent helicase CPE1197
*
Listeria monocytogenes EGD-e

Site:
position = -57
score = 4.25077
sequence = TGTTGCGAACGTAGGTTCTGTGTT

Gene: lmo0157: DinG family ATP-dependent helicase CPE1197
 
Listeria seeligeri serovar 1/2b str. SLCC3954

Gene: lse_0136: DinG family ATP-dependent helicase CPE1197
 
Listeria welshimeri serovar 6b str. SLCC5334

Gene: lwe0133: DinG family ATP-dependent helicase CPE1197
DinG family ATP-dependent helicase CPE1197
yxeH
 
Listeria innocua Clip11262

Gene: lin0196: Cof-like hydrolase
 
Listeria monocytogenes EGD-e

Gene: lmo0158: Cof-like hydrolase
 
Listeria seeligeri serovar 1/2b str. SLCC3954

Gene: lse_0137: Cof-like hydrolase
 
Listeria welshimeri serovar 6b str. SLCC5334

Gene: lwe0134: Cof-like hydrolase
Cof-like hydrolase
 
CRON 11.
lin1681
*
Listeria innocua Clip11262

Site:
position = -47
score = 4.64164
sequence = AAAAGGGAACGTATGTTTTATGAT

Gene: lin1681: Conserved hypothetical protein
*
Listeria monocytogenes EGD-e

Site:
position = -47
score = 4.93443
sequence = AAAACAGAACATATGTTTTATCAT

Gene: lmo1640: Conserved hypothetical protein
*
Listeria seeligeri serovar 1/2b str. SLCC3954

Site:
position = -47
score = 4.72754
sequence = AAAATAGAACGTATGTTTTATGAT

Gene: lse_1561: Conserved hypothetical protein
*
Listeria welshimeri serovar 6b str. SLCC5334

Site:
position = -47
score = 5.14336
sequence = AAAACAGAACATATGTTTTATGAT

Gene: lwe1656: Conserved hypothetical protein
Conserved hypothetical protein
tag
 
Listeria innocua Clip11262

Gene: lin1680: DNA-3-methyladenine glycosylase (EC 3.2.2.20)
 
Listeria monocytogenes EGD-e

Gene: lmo1639: DNA-3-methyladenine glycosylase (EC 3.2.2.20)
 
Listeria seeligeri serovar 1/2b str. SLCC3954

Gene: lse_1560: DNA-3-methyladenine glycosylase (EC 3.2.2.20)
 
Listeria welshimeri serovar 6b str. SLCC5334

Gene: lwe1655: DNA-3-methyladenine glycosylase (EC 3.2.2.20)
DNA-3-methyladenine glycosylase (EC 3.2.2.20)
lin1679
 
Listeria innocua Clip11262

Gene: lin1679: Putative carboxypeptidase
 
Listeria monocytogenes EGD-e

Gene: lmo1638: Putative carboxypeptidase
 
Listeria seeligeri serovar 1/2b str. SLCC3954

Gene: lse_1559: Putative carboxypeptidase
 
Listeria welshimeri serovar 6b str. SLCC5334

Gene: lwe1654: Putative carboxypeptidase
Putative carboxypeptidase
 
CRON 12.
int
*
Listeria innocua Clip11262

Site:
position = -33
score = 4.63328
sequence = AAAAAAGAACGTATGTGCGAAAGG

Gene: lin2426: Integrase
*
Listeria monocytogenes EGD-e

Site:
position = -33
score = 4.63328
sequence = AAAAAAGAACGTATGTGCGAAAGG

Gene: lmo2332: Integrase
 
Listeria seeligeri serovar 1/2b str. SLCC3954
 
Listeria welshimeri serovar 6b str. SLCC5334
Integrase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD