Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog LexA - Alcaligenaceae

Properties
Regulator type: Transcription factor
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 19 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bordetella avium 197N 12 7
Bordetella bronchiseptica RB50 11 6
Bordetella petrii DSM 12804 11 6
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
imuA
*
Bordetella avium 197N

Site:
position = -39
score = 6.38455
sequence = TACTGTATATTCATACAGTA

Gene: BAV2027: Predicted RecA/RadA recombinase
*
Bordetella bronchiseptica RB50

Site:
position = -35
score = 6.29404
sequence = TACTGTATATTTATACAGTG

Gene: BB3086: Predicted RecA/RadA recombinase
*
Bordetella petrii DSM 12804

Site:
position = 60
score = 6.31428
sequence = TACTGTATATTTGTACAGTA

Gene: Bpet2611: Predicted RecA/RadA recombinase
Predicted RecA/RadA recombinase
imuB
 
Bordetella avium 197N

Gene: BAV2028: DNA polymerase-like protein PA0670
 
Bordetella bronchiseptica RB50

Gene: BB3087: DNA polymerase-like protein PA0670
 
Bordetella petrii DSM 12804

Gene: Bpet2612: DNA polymerase-like protein PA0670
DNA polymerase-like protein PA0670
dnaE2
 
Bordetella avium 197N

Gene: BAV2029: DNA polymerase III alpha subunit (EC 2.7.7.7)
 
Bordetella bronchiseptica RB50

Gene: BB3088: DNA polymerase III alpha subunit (EC 2.7.7.7)
 
Bordetella petrii DSM 12804

Gene: Bpet2613: DNA polymerase III alpha subunit (EC 2.7.7.7)
DNA polymerase III alpha subunit (EC 2.7.7.7)
 
CRON 2.
uvrD
*
Bordetella avium 197N

Site:
position = -27
score = 5.72181
sequence = GTCTGTATATATATACAGTG

Gene: BAV2545: ATP-dependent DNA helicase II
*
Bordetella bronchiseptica RB50

Site:
position = -41
score = 6.29404
sequence = TTCTGTATAAATATACAGTA

Gene: BB1810: ATP-dependent DNA helicase II
*
Bordetella petrii DSM 12804

Site:
position = -6
score = 5.55582
sequence = GTCTGGATGAATATACAGTA

Gene: Bpet3400: ATP-dependent DNA helicase II
ATP-dependent DNA helicase II
 
CRON 3.
uvrA
*
Bordetella avium 197N

Site:
position = -134
score = 5.83279
sequence = TACTGTTTATCTATACAGCA

Gene: BAV2808: Excinuclease ABC subunit A
*
Bordetella bronchiseptica RB50

Site:
position = -150
score = 6.08441
sequence = TACTGTTTATTTATACAGCA

Gene: BB4032: Excinuclease ABC subunit A
*
Bordetella petrii DSM 12804

Site:
position = -180
score = 5.66923
sequence = TACTGTTTATATATACAGAT

Gene: Bpet0873: Excinuclease ABC subunit A
Excinuclease ABC subunit A
pabB
 
Bordetella avium 197N

Gene: BAV2809: Para-aminobenzoate synthase, aminase component (EC 2.6.1.85)
 
Bordetella bronchiseptica RB50

Gene: BB4033: Para-aminobenzoate synthase, aminase component (EC 2.6.1.85)
 
Bordetella petrii DSM 12804

Gene: Bpet0872: Para-aminobenzoate synthase, aminase component (EC 2.6.1.85)
Para-aminobenzoate synthase, aminase component (EC 2.6.1.85)
pabC
 
Bordetella avium 197N

Gene: BAV2810: Aminodeoxychorismate lyase (EC 4.1.3.38)
 
Bordetella bronchiseptica RB50

Gene: BB4034: Aminodeoxychorismate lyase (EC 4.1.3.38)
 
Bordetella petrii DSM 12804

Gene: Bpet0871: Aminodeoxychorismate lyase (EC 4.1.3.38)
Aminodeoxychorismate lyase (EC 4.1.3.38)
 
CRON 4.
recA
*
Bordetella avium 197N

Site:
position = -172
score = 5.83846
sequence = TACTGTTTGTTTGTACAGTA

Gene: BAV2309: Recombinase A
*
Bordetella bronchiseptica RB50

Site:
position = -135
score = 5.68144
sequence = CACTGGATTTTTATCCAGTA

Gene: BB2076: Recombinase A
*
Bordetella petrii DSM 12804

Site:
position = -136
score = 5.99956
sequence = TACTGGATTTTTATCCAGTA

Gene: Bpet2056: Recombinase A
Recombinase A
recX
 
Bordetella avium 197N

Gene: BAV2308: Regulatory protein RecX
 
Bordetella bronchiseptica RB50

Gene: BB2077: Regulatory protein RecX
 
Bordetella petrii DSM 12804

Gene: Bpet2057: Regulatory protein RecX
Regulatory protein RecX
 
CRON 5.
PF4055
*
Bordetella avium 197N

Site:
position = -28
score = 5.7183
sequence = TACTGTGTTTTTGTACAGTA

Gene: BAV1370: DNA repair photolyase
*
Bordetella bronchiseptica RB50

Site:
position = -25
score = 5.28428
sequence = TACTGCGTTTTTGTACAGTA

Gene: BB3446: DNA repair photolyase
*
Bordetella petrii DSM 12804

Site:
position = -25
score = 5.64596
sequence = TACTGGTTTTTTGTACAGTA

Gene: Bpet1911: DNA repair photolyase
DNA repair photolyase
 
CRON 6.
lexA
*
Bordetella avium 197N

Site:
position = -62
score = 5.53278
sequence = CGCTGTATATACATACAGTC

Gene: BAV1503: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Bordetella bronchiseptica RB50

Site:
position = 38
score = 5.21716
sequence = CGCTGTATATCCATACAGTC

Gene: BB2271: SOS-response repressor and protease LexA (EC 3.4.21.88)
*
Bordetella petrii DSM 12804

Site:
position = -39
score = 5.53528
sequence = TGCTGTATATCCATACAGTC

Gene: Bpet2782: SOS-response repressor and protease LexA (EC 3.4.21.88)
SOS-response repressor and protease LexA (EC 3.4.21.88)
 
CRON 7.
dinB
*
Bordetella avium 197N

Site:
position = -44
score = 5.9442
sequence = TACCGTATATTTATCCAGTA

Gene: BAV2034: DNA polymerase IV (EC 2.7.7.7)
 
Bordetella bronchiseptica RB50

Gene: BB3093: DNA polymerase IV (EC 2.7.7.7)
 
Bordetella petrii DSM 12804

Gene: Bpet2618: DNA polymerase IV (EC 2.7.7.7)
DNA polymerase IV (EC 2.7.7.7)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD