Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HrcA - Chlamydiales

Properties
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Chlamydiae
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 14 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Chlamydia muridarum Nigg 5 2
Chlamydia trachomatis D/UW-3/CX 5 2
Chlamydophila abortus S26/3 5 2
Chlamydophila felis Fe/C-56 5 2
Chlamydophila pneumoniae AR39 5 2
Parachlamydia sp. UWE25 5 2
Chlamydophila caviae GPIC 5 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
hcrA
*
Chlamydia muridarum Nigg

Site:
position = -72
score = 5.80511
sequence = CTAGCACTCTTTGCTCGCGAGCGCTAA

Gene: TC0673: Heat shock response transcriptional regulator HrcA, HrcA family
*
Chlamydia trachomatis D/UW-3/CX

Site:
position = -72
score = 5.99475
sequence = CTAGCACTCTTTAGTTGCGAGCGCTAA

Gene: CT394: Heat shock response transcriptional regulator HrcA, HrcA family
*
Chlamydophila abortus S26/3

Site:
position = -101
score = 6.00025
sequence = TTAGCATTCTTTGAGGTTGAGTGCCAA

Gene: CAB239: Heat shock response transcriptional regulator HrcA, HrcA family
*
Chlamydophila felis Fe/C-56

Site:
position = -101
score = 6.20308
sequence = TTAGCATTCTTTAGAGGTGAGTGCTAA

Gene: CF0763: Heat shock response transcriptional regulator HrcA, HrcA family
*
Chlamydophila pneumoniae AR39

Site:
position = -33
score = 6.56516
sequence = TTAGCATTCATTCAATTCGAGTGCTAA

Gene: CP0253: Heat shock response transcriptional regulator HrcA, HrcA family
*
Parachlamydia sp. UWE25

Site:
position = -90
score = 7.19408
sequence = ATAGCACTCGATATAATCGAGTGCTAA

Gene: pc1497: Heat shock response transcriptional regulator HrcA, HrcA family
*
Chlamydophila caviae GPIC

Site:
position = -101
score = 6.75112
sequence = TTAGCATTCTTTAGAATCGAGTGCTAA

Gene: CCA00243: Heat shock response transcriptional regulator HrcA, HrcA family
Heat shock response transcriptional regulator HrcA, HrcA family
grpE
 
Chlamydia muridarum Nigg

Gene: TC0674: Heat shock protein GrpE
 
Chlamydia trachomatis D/UW-3/CX

Gene: CT395: Heat shock protein GrpE
 
Chlamydophila abortus S26/3

Gene: CAB238: Heat shock protein GrpE
 
Chlamydophila felis Fe/C-56

Gene: CF0764: Heat shock protein GrpE
 
Chlamydophila pneumoniae AR39

Gene: CP0252: Heat shock protein GrpE
 
Parachlamydia sp. UWE25

Gene: pc1498: Heat shock protein GrpE
 
Chlamydophila caviae GPIC

Gene: CCA00242: Heat shock protein GrpE
Heat shock protein GrpE
dnaK
 
Chlamydia muridarum Nigg

Gene: TC0675: Chaperone protein DnaK
 
Chlamydia trachomatis D/UW-3/CX

Gene: CT396: Chaperone protein DnaK
 
Chlamydophila abortus S26/3

Gene: CAB237: Chaperone protein DnaK
 
Chlamydophila felis Fe/C-56

Gene: CF0765: Chaperone protein DnaK
 
Chlamydophila pneumoniae AR39

Gene: CP0251: Chaperone protein DnaK
 
Parachlamydia sp. UWE25

Gene: pc1499: Chaperone protein DnaK
 
Chlamydophila caviae GPIC

Gene: CCA00241: Chaperone protein DnaK
Chaperone protein DnaK
 
CRON 2.
groS
*
Chlamydia muridarum Nigg

Site:
position = -161
score = 6.09127
sequence = ATAGCAGTTGAGGTGCTCAACTGCTAA

Gene: TC0387: Heat shock protein 60 family co-chaperone GroES
*
Chlamydia trachomatis D/UW-3/CX

Site:
position = -161
score = 6.12456
sequence = ATAGCAGTTGATCATGCCAACTGCTAA

Gene: CT111: Heat shock protein 60 family co-chaperone GroES
*
Chlamydophila abortus S26/3

Site:
position = -113
score = 6.5831
sequence = ATGGCGCTTGATATTATTAAGTGCTAA

Gene: CAB614: Heat shock protein 60 family co-chaperone GroES
*
Chlamydophila felis Fe/C-56

Site:
position = -113
score = 7.24756
sequence = ATAGCACTTGATATTATTAAGTGCTAA

Gene: CF0366: Heat shock protein 60 family co-chaperone GroES
*
Chlamydophila pneumoniae AR39

Site:
position = -113
score = 7.1908
sequence = TTAGCACTTAAAATTATTGAGTGCTAA

Gene: CP0637: Heat shock protein 60 family co-chaperone GroES
*
Parachlamydia sp. UWE25

Site:
position = -138
score = 6.00218
sequence = TTAGCAATTAAGTTGATTCACTGCTAA

Gene: pc1179: Heat shock protein 60 family co-chaperone GroES
*
Chlamydophila caviae GPIC

Site:
position = -116
score = 7.06108
sequence = GTAGCACTTGATATTATTAAGTGCTAA

Gene: CCA00642: Heat shock protein 60 family co-chaperone GroES
Heat shock protein 60 family co-chaperone GroES
groL
 
Chlamydia muridarum Nigg

Gene: TC0386: Heat shock protein 60 family chaperone GroEL
 
Chlamydia trachomatis D/UW-3/CX

Gene: CT110: Heat shock protein 60 family chaperone GroEL
 
Chlamydophila abortus S26/3

Gene: CAB615: Heat shock protein 60 family chaperone GroEL
 
Chlamydophila felis Fe/C-56

Gene: CF0365: Heat shock protein 60 family chaperone GroEL
 
Chlamydophila pneumoniae AR39

Gene: CP0638: Heat shock protein 60 family chaperone GroEL
 
Parachlamydia sp. UWE25

Gene: pc1180: Heat shock protein 60 family chaperone GroEL
 
Chlamydophila caviae GPIC

Gene: CCA00643: Heat shock protein 60 family chaperone GroEL
Heat shock protein 60 family chaperone GroEL
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD