Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HrcA - Thermoanaerobacterales

Properties
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode:
Biological process: Heat shock response
Effector: Heat shock
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 15 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Anaerocellum thermophilum DSM 6725 6 2
Caldicellulosiruptor saccharolyticus DSM 8903 6 2
Carboxydothermus hydrogenoformans Z-2901 7 2
Thermoanaerobacter ethanolicus X514 6 2
Thermoanaerobacter italicus Ab9 6 2
Thermoanaerobacter tengcongensis MB4 6 2
Moorella thermoacetica ATCC 39073 8 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
hrcA
*
Anaerocellum thermophilum DSM 6725

Site:
position = -43
score = 7.40307
sequence = TTAGCACTCATCAACAGAGAGTGCTAA

Gene: Athe_1553: Heat shock response transcriptional regulator HrcA, HrcA family
*
Caldicellulosiruptor saccharolyticus DSM 8903

Site:
position = -43
score = 7.43261
sequence = TTAGCACTCATCAAATGAGAGTGCTAA

Gene: Csac_1750: Heat shock response transcriptional regulator HrcA, HrcA family
*
Carboxydothermus hydrogenoformans Z-2901

Site:
position = -46
score = 7.60419
sequence = TTAGCACTCAACAAAAGAGAGTGCTAA

Gene: CHY_0412: Heat shock response transcriptional regulator HrcA, HrcA family
*
Thermoanaerobacter ethanolicus X514

Site:
position = -47
score = 7.48761
sequence = TTAGCACTCAATCGAGTAGAGTGCTAA

Gene: Teth514_2081: Heat shock response transcriptional regulator HrcA, HrcA family
*
Thermoanaerobacter italicus Ab9

Site:
position = -47
score = 7.71617
sequence = TTAGCACTCAACTTGATTGAGTGCTAA

Gene: Thit_0892: Heat shock response transcriptional regulator HrcA, HrcA family
*
Thermoanaerobacter tengcongensis MB4

Site:
position = -47
score = 7.46072
sequence = TTAGCACTCAATGAGTGAGAGTGCTAA

Gene: TTE0953: Heat shock response transcriptional regulator HrcA, HrcA family
*
Moorella thermoacetica ATCC 39073

Site:
position = -46
score = 6.72588
sequence = TTAGCACTCGGAACATAAGAGTGCTAA

Gene: Moth_0583: Heat shock response transcriptional regulator HrcA, HrcA family
Heat shock response transcriptional regulator HrcA, HrcA family
groL2
 
Anaerocellum thermophilum DSM 6725
 
Caldicellulosiruptor saccharolyticus DSM 8903
 
Carboxydothermus hydrogenoformans Z-2901

Gene: CHY_0413: Heat shock protein 60 family chaperone GroEL
 
Thermoanaerobacter ethanolicus X514
 
Thermoanaerobacter italicus Ab9
 
Thermoanaerobacter tengcongensis MB4
 
Moorella thermoacetica ATCC 39073
Heat shock protein 60 family chaperone GroEL
grpE
 
Anaerocellum thermophilum DSM 6725

Gene: Athe_1552: Heat shock protein GrpE
 
Caldicellulosiruptor saccharolyticus DSM 8903

Gene: Csac_1751: Heat shock protein GrpE
 
Carboxydothermus hydrogenoformans Z-2901

Gene: CHY_0414: Heat shock protein GrpE
 
Thermoanaerobacter ethanolicus X514

Gene: Teth514_2080: Heat shock protein GrpE
 
Thermoanaerobacter italicus Ab9

Gene: Thit_0893: Heat shock protein GrpE
 
Thermoanaerobacter tengcongensis MB4

Gene: TTE0954: Heat shock protein GrpE
 
Moorella thermoacetica ATCC 39073

Gene: Moth_0584: Heat shock protein GrpE
Heat shock protein GrpE
dnaK
 
Anaerocellum thermophilum DSM 6725

Gene: Athe_1551: Chaperone protein DnaK
 
Caldicellulosiruptor saccharolyticus DSM 8903

Gene: Csac_1752: Chaperone protein DnaK
 
Carboxydothermus hydrogenoformans Z-2901

Gene: CHY_0415: Chaperone protein DnaK
 
Thermoanaerobacter ethanolicus X514

Gene: Teth514_2079: Chaperone protein DnaK
 
Thermoanaerobacter italicus Ab9

Gene: Thit_0894: Chaperone protein DnaK
 
Thermoanaerobacter tengcongensis MB4

Gene: TTE0955: Chaperone protein DnaK
 
Moorella thermoacetica ATCC 39073

Gene: Moth_0585: Chaperone protein DnaK
Chaperone protein DnaK
dnaJ
 
Anaerocellum thermophilum DSM 6725

Gene: Athe_1550: Chaperone protein DnaJ
 
Caldicellulosiruptor saccharolyticus DSM 8903

Gene: Csac_1753: Chaperone protein DnaJ
 
Carboxydothermus hydrogenoformans Z-2901

Gene: CHY_0416: Chaperone protein DnaJ
 
Thermoanaerobacter ethanolicus X514

Gene: Teth514_2078: Chaperone protein DnaJ
 
Thermoanaerobacter italicus Ab9

Gene: Thit_0895: Chaperone protein DnaJ
 
Thermoanaerobacter tengcongensis MB4

Gene: TTE0956: Chaperone protein DnaJ
 
Moorella thermoacetica ATCC 39073

Gene: Moth_0586: Chaperone protein DnaJ
Chaperone protein DnaJ
 
CRON 2.
groS
*
Anaerocellum thermophilum DSM 6725

Site:
position = -54
score = 7.68586
sequence = TTAGCACTCATTGAAAGTGAGTGCTAA

Gene: Athe_2138: Heat shock protein 60 family co-chaperone GroES
*
Caldicellulosiruptor saccharolyticus DSM 8903

Site:
position = -54
score = 7.55228
sequence = TTAGCACTCACTCTCAATGAGTGCTAA

Gene: Csac_1291: Heat shock protein 60 family co-chaperone GroES
*
Carboxydothermus hydrogenoformans Z-2901

Site:
position = -67
score = 7.52483
sequence = TTAGCACTCTATCGAAGTGAGTGCTAA

Gene: CHY_0806: Heat shock protein 60 family co-chaperone GroES
*
Thermoanaerobacter ethanolicus X514

Site:
position = -53
score = 7.75676
sequence = TTAGCACTCACATAAGTTGAGTGCTAA

Gene: Teth514_0512: Heat shock protein 60 family co-chaperone GroES
*
Thermoanaerobacter italicus Ab9

Site:
position = -53
score = 7.75676
sequence = TTAGCACTCACATAAGTTGAGTGCTAA

Gene: Thit_0563: Heat shock protein 60 family co-chaperone GroES
*
Thermoanaerobacter tengcongensis MB4

Site:
position = -54
score = 7.56724
sequence = TTAGCACTCATAGAAGTTGAGTGCTAA

Gene: TTE0579: Heat shock protein 60 family co-chaperone GroES
*2
Moorella thermoacetica ATCC 39073

Site:
position = -61
score = 6.69853
sequence = TTAGCACTTGAGTCCGGTGAGTGCTAA

Gene: Moth_0545: Heat shock protein 60 family co-chaperone GroES

Site:
position = -50
score = 6.82089
sequence = CTAGCACTCTCTAAAATAAAGTGCTAA

Gene: Moth_2130: Heat shock protein 60 family co-chaperone GroES
Heat shock protein 60 family co-chaperone GroES
groL
 
Anaerocellum thermophilum DSM 6725

Gene: Athe_2137: Heat shock protein 60 family chaperone GroEL
 
Caldicellulosiruptor saccharolyticus DSM 8903

Gene: Csac_1292: Heat shock protein 60 family chaperone GroEL
 
Carboxydothermus hydrogenoformans Z-2901

Gene: CHY_0807: Heat shock protein 60 family chaperone GroEL
 
Thermoanaerobacter ethanolicus X514

Gene: Teth514_0513: Heat shock protein 60 family chaperone GroEL
 
Thermoanaerobacter italicus Ab9

Gene: Thit_0564: Heat shock protein 60 family chaperone GroEL
 
Thermoanaerobacter tengcongensis MB4

Gene: TTE0580: Heat shock protein 60 family chaperone GroEL
 2
Moorella thermoacetica ATCC 39073

Gene: Moth_2129: Heat shock protein 60 family chaperone GroEL

Gene: Moth_0546: Heat shock protein 60 family chaperone GroEL
Heat shock protein 60 family chaperone GroEL
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD