Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HrcA - Listeriaceae

Properties
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Listeria innocua Clip11262 6 2
Listeria monocytogenes EGD-e 6 2
Listeria seeligeri serovar 1/2b str. SLCC3954 6 2
Listeria welshimeri serovar 6b str. SLCC5334 6 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
hrcA
*
Listeria innocua Clip11262

Site:
position = -41
score = 7.46002
sequence = TTAGCACTTGACGTTATTGAGTGCTAA

Gene: lin1512: Heat shock response transcriptional regulator HrcA, HrcA family
*
Listeria monocytogenes EGD-e

Site:
position = -41
score = 7.33877
sequence = TTAGCACTTGACGTTATGGAGTGCTAA

Gene: lmo1475: Heat shock response transcriptional regulator HrcA, HrcA family
*
Listeria seeligeri serovar 1/2b str. SLCC3954

Site:
position = -41
score = 7.46002
sequence = TTAGCACTTGACGTTATTGAGTGCTAA

Gene: lse_1392: Heat shock response transcriptional regulator HrcA, HrcA family
*
Listeria welshimeri serovar 6b str. SLCC5334

Site:
position = -41
score = 7.41436
sequence = TTAGCACTTGATGTTATTGAGTGCTAA

Gene: lwe1490: Heat shock response transcriptional regulator HrcA, HrcA family
Heat shock response transcriptional regulator HrcA, HrcA family
grpE
 
Listeria innocua Clip11262

Gene: lin1511: Heat shock protein GrpE
 
Listeria monocytogenes EGD-e

Gene: lmo1474: Heat shock protein GrpE
 
Listeria seeligeri serovar 1/2b str. SLCC3954

Gene: lse_1391: Heat shock protein GrpE
 
Listeria welshimeri serovar 6b str. SLCC5334

Gene: lwe1489: Heat shock protein GrpE
Heat shock protein GrpE
dnaK
 
Listeria innocua Clip11262

Gene: lin1510: Chaperone protein DnaK
 
Listeria monocytogenes EGD-e

Gene: lmo1473: Chaperone protein DnaK
 
Listeria seeligeri serovar 1/2b str. SLCC3954

Gene: lse_1390: Chaperone protein DnaK
 
Listeria welshimeri serovar 6b str. SLCC5334

Gene: lwe1488: Chaperone protein DnaK
Chaperone protein DnaK
dnaJ
 
Listeria innocua Clip11262

Gene: lin1509: Chaperone protein DnaJ
 
Listeria monocytogenes EGD-e

Gene: lmo1472: Chaperone protein DnaJ
 
Listeria seeligeri serovar 1/2b str. SLCC3954

Gene: lse_1389: Chaperone protein DnaJ
 
Listeria welshimeri serovar 6b str. SLCC5334

Gene: lwe1487: Chaperone protein DnaJ
Chaperone protein DnaJ
 
CRON 2.
groS
*
Listeria innocua Clip11262

Site:
position = -65
score = 7.58851
sequence = TTAGCACTCTAATGTGTCGAGTGCTAA

Gene: lin2175: Heat shock protein 60 family co-chaperone GroES
*
Listeria monocytogenes EGD-e

Site:
position = -65
score = 7.33051
sequence = TTAGCACTCTGATGTGTCGAGTGCTAA

Gene: lmo2069: Heat shock protein 60 family co-chaperone GroES
*
Listeria seeligeri serovar 1/2b str. SLCC3954

Site:
position = -64
score = 7.58851
sequence = TTAGCACTCTAATGTGTCGAGTGCTAA

Gene: lse_2058: Heat shock protein 60 family co-chaperone GroES
*
Listeria welshimeri serovar 6b str. SLCC5334

Site:
position = -65
score = 7.28485
sequence = TTAGCACTCTGATGCGTCGAGTGCTAA

Gene: lwe2090: Heat shock protein 60 family co-chaperone GroES
Heat shock protein 60 family co-chaperone GroES
groL
 
Listeria innocua Clip11262

Gene: lin2174: Heat shock protein 60 family chaperone GroEL
 
Listeria monocytogenes EGD-e

Gene: lmo2068: Heat shock protein 60 family chaperone GroEL
 
Listeria seeligeri serovar 1/2b str. SLCC3954

Gene: lse_2057: Heat shock protein 60 family chaperone GroEL
 
Listeria welshimeri serovar 6b str. SLCC5334

Gene: lwe2089: Heat shock protein 60 family chaperone GroEL
Heat shock protein 60 family chaperone GroEL
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD