Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HrcA - Deinococcus-Thermus

Properties
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Deinococcus-Thermus
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Deinococcus deserti VCD115
Deinococcus geothermalis DSM 11300
Deinococcus radiodurans R1
Thermus aquaticus Y51MC23 3 2
Thermus thermophilus HB27 3 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
groS
 
Deinococcus deserti VCD115

Gene: Deide_22580: Heat shock protein 60 family co-chaperone GroES
 
Deinococcus geothermalis DSM 11300

Gene: Dgeo_2230: Heat shock protein 60 family co-chaperone GroES
 
Deinococcus radiodurans R1

Gene: DR_0606: Heat shock protein 60 family co-chaperone GroES
*
Thermus aquaticus Y51MC23

Site:
position = -41
score = 6.98441
sequence = TTGACACTCTCGCCCTTGGAGCGTCAA

Gene: TaqDRAFT_4600: Heat shock protein 60 family co-chaperone GroES
*
Thermus thermophilus HB27

Site:
position = -41
score = 7.03413
sequence = TTGACACTCTCACCCTTTGGGCGTCAA

Gene: TTC1713: Heat shock protein 60 family co-chaperone GroES
Heat shock protein 60 family co-chaperone GroES
groL
 
Deinococcus deserti VCD115

Gene: Deide_22590: Heat shock protein 60 family chaperone GroEL
 
Deinococcus geothermalis DSM 11300

Gene: Dgeo_2231: Heat shock protein 60 family chaperone GroEL
 
Deinococcus radiodurans R1

Gene: DR0607: Heat shock protein 60 family chaperone GroEL
 
Thermus aquaticus Y51MC23

Gene: TaqDRAFT_4601: Heat shock protein 60 family chaperone GroEL
 
Thermus thermophilus HB27

Gene: TTC1714: Heat shock protein 60 family chaperone GroEL
Heat shock protein 60 family chaperone GroEL
 
CRON 2.
COG2331
 
Deinococcus deserti VCD115

Gene: Deide_21540: Conserved hypothetical protein
 
Deinococcus geothermalis DSM 11300

Gene: Dgeo_0104: Conserved hypothetical protein
 
Deinococcus radiodurans R1

Gene: DR0301: Conserved hypothetical protein
*
Thermus aquaticus Y51MC23

Site:
position = -50
score = 7.24035
sequence = TTGACACTCAATGGCTTTGAGTGTCAG

Gene: TaqDRAFT_5069: Conserved hypothetical protein
*
Thermus thermophilus HB27

Site:
position = -50
score = 6.43415
sequence = TTGACACTCAAGAAGGCTAAGCGTCAA

Gene: TTC1246: Conserved hypothetical protein
Conserved hypothetical protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD