Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HrcA - Chlorobiales

Properties
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Chlorobi
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 11 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Chlorobaculum parvum NCIB 8327 2 1
Chlorobium chlorochromatii CaD3 2 1
Chlorobium ferrooxidans DSM 13031
Chlorobium limicola DSM 245 2 1
Chlorobium phaeobacteroides BS1 2 1
Chlorobium phaeobacteroides DSM 266 2 1
Chloroherpeton thalassium ATCC 35110 2 1
Pelodictyon luteolum DSM 273 2 1
Pelodictyon phaeoclathratiforme BU-1 2 1
Prosthecochloris aestuarii DSM 271 2 1
Prosthecochloris vibrioformis DSM 265 2 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
groS
*
Chlorobaculum parvum NCIB 8327

Site:
position = -115
score = 7.66838
sequence = TTAGCACTCTCGTTAGGTGAGTGCTAA

Gene: Cpar_1367: Heat shock protein 60 family co-chaperone GroES
*
Chlorobium chlorochromatii CaD3

Site:
position = -101
score = 7.2912
sequence = TTAGCACTCTCACCTCGAGAGTGCTAA

Gene: Cag_1305: Heat shock protein 60 family co-chaperone GroES
 
Chlorobium ferrooxidans DSM 13031
*
Chlorobium limicola DSM 245

Site:
position = -96
score = 7.24959
sequence = TTAGCACTCTTGTCCATTGAGTGCTAA

Gene: Clim_0497: Heat shock protein 60 family co-chaperone GroES
*
Chlorobium phaeobacteroides BS1

Site:
position = -107
score = 7.40848
sequence = TTAGCACTCGGTGTTGTAGAGTGCTAA

Gene: Cphamn1_0782: Heat shock protein 60 family co-chaperone GroES
*
Chlorobium phaeobacteroides DSM 266

Site:
position = -93
score = 7.33565
sequence = TTAGCACTCTTCCGTTGAGAGTGCTAA

Gene: Cpha266_1937: Heat shock protein 60 family co-chaperone GroES
*
Chloroherpeton thalassium ATCC 35110

Site:
position = -188
score = 7.8291
sequence = TTAGCACTCTATTAAGGAGAGTGCTAA

Site:
position = -113
score = 7.8291
sequence = TTAGCACTCTATTAAGGAGAGTGCTAA

Gene: Ctha_1617: Heat shock protein 60 family co-chaperone GroES
*
Pelodictyon luteolum DSM 273

Site:
position = -95
score = 7.42042
sequence = TTAGCACTCGGCGTTGTTGAGTGCTAA

Gene: Plut_0541: Heat shock protein 60 family co-chaperone GroES
*
Pelodictyon phaeoclathratiforme BU-1

Site:
position = -97
score = 7.58327
sequence = TTAGCACTCGACTCTGTTGAGTGCTAA

Gene: Ppha_0833: Heat shock protein 60 family co-chaperone GroES
*
Prosthecochloris aestuarii DSM 271

Site:
position = -106
score = 7.69854
sequence = TTAGCACTCAACAAAAGAGAGTGCTAA

Gene: Paes_0679: Heat shock protein 60 family co-chaperone GroES
*
Prosthecochloris vibrioformis DSM 265

Site:
position = -100
score = 7.11954
sequence = TTAGCACTCATCGTTTCCGAGTGCTAA

Gene: Cvib_0585: Heat shock protein 60 family co-chaperone GroES
Heat shock protein 60 family co-chaperone GroES
groL
 
Chlorobaculum parvum NCIB 8327

Gene: Cpar_1366: Heat shock protein 60 family chaperone GroEL
 
Chlorobium chlorochromatii CaD3

Gene: Cag_1306: Heat shock protein 60 family chaperone GroEL
 
Chlorobium ferrooxidans DSM 13031
 
Chlorobium limicola DSM 245

Gene: Clim_0498: Heat shock protein 60 family chaperone GroEL
 
Chlorobium phaeobacteroides BS1

Gene: Cphamn1_0783: Heat shock protein 60 family chaperone GroEL
 
Chlorobium phaeobacteroides DSM 266

Gene: Cpha266_1936: Heat shock protein 60 family chaperone GroEL
 
Chloroherpeton thalassium ATCC 35110

Gene: Ctha_1618: Heat shock protein 60 family chaperone GroEL
 
Pelodictyon luteolum DSM 273

Gene: Plut_0542: Heat shock protein 60 family chaperone GroEL
 
Pelodictyon phaeoclathratiforme BU-1

Gene: Ppha_0834: Heat shock protein 60 family chaperone GroEL
 
Prosthecochloris aestuarii DSM 271

Gene: Paes_0680: Heat shock protein 60 family chaperone GroEL
 
Prosthecochloris vibrioformis DSM 265

Gene: Cvib_0586: Heat shock protein 60 family chaperone GroEL
Heat shock protein 60 family chaperone GroEL
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD