Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HrcA - Streptomycetaceae

Properties
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 24 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Streptomyces avermitilis MA-4680 6 4
Streptomyces coelicolor A3(2) 6 4
Streptomyces griseus subsp. griseus NBRC 13350 6 4
Streptomyces scabiei 87.22 6 4
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
COG2331
*
Streptomyces avermitilis MA-4680

Site:
position = -38
score = 6.71561
sequence = TTAGCACTCACTGAGTGAGAGTGCCAG

Gene: SAV_3678: Conserved hypothetical protein
*
Streptomyces coelicolor A3(2)

Site:
position = -37
score = 6.638
sequence = TTAGCACTCATCGAGTGAGAGTGCCAG

Gene: SCO3187: Conserved hypothetical protein
*
Streptomyces griseus subsp. griseus NBRC 13350

Site:
position = -36
score = 6.47589
sequence = TTAGCACTCATTGAGTGAGAGTGCCAG

Gene: SGR_4291: Conserved hypothetical protein
*
Streptomyces scabiei 87.22

Site:
position = -38
score = 6.638
sequence = TTAGCACTCATCGAGTGAGAGTGCCAG

Gene: SCAB_53081: Conserved hypothetical protein
Conserved hypothetical protein
 
CRON 2.
groL2
*
Streptomyces avermitilis MA-4680

Site:
position = -153
score = 6.62413
sequence = TTAGCACTCTGAAGGTGAGAGTGATAA

Site:
position = -189
score = 6.87439
sequence = CTTGCACTCGGCAGGGGCGAGTGCTAA

Gene: SAV_3931: Heat shock protein 60 family chaperone GroEL
*
Streptomyces coelicolor A3(2)

Site:
position = -189
score = 6.53625
sequence = CTTGCACTCGACCATGCCGAGTGCTAA

Site:
position = -153
score = 6.67418
sequence = TTAGCACTCTGAAGGTGAGAGTGACAA

Gene: SCO4296: Heat shock protein 60 family chaperone GroEL
*
Streptomyces griseus subsp. griseus NBRC 13350

Site:
position = -190
score = 6.55703
sequence = CTTGCACTCGCAGGGGTCGAGTGCTAA

Site:
position = -154
score = 6.78709
sequence = TTAGCACTCTCCAGGTGAGAGTGACAG

Gene: SGR_3225: Heat shock protein 60 family chaperone GroEL
*
Streptomyces scabiei 87.22

Site:
position = -153
score = 6.67418
sequence = TTAGCACTCTGAAGGTGAGAGTGACAA

Site:
position = -189
score = 6.82832
sequence = CTTGCACTCGCAGGGGGCGAGTGCTAA

Gene: SCAB_50441: Heat shock protein 60 family chaperone GroEL
Heat shock protein 60 family chaperone GroEL
 
CRON 3.
hrcA
*
Streptomyces avermitilis MA-4680

Site:
position = -62
score = 6.70631
sequence = CTGGCACTCGCGCGCGCTGAGTGCCAG

Gene: SAV_5569: Heat shock response transcriptional regulator HrcA, HrcA family
*
Streptomyces coelicolor A3(2)

Site:
position = -110
score = 6.2101
sequence = CTGGCACTCGCGAGCCATGAGTGCCAG

Gene: SCO2555: Heat shock response transcriptional regulator HrcA, HrcA family
*
Streptomyces griseus subsp. griseus NBRC 13350

Site:
position = -62
score = 6.57582
sequence = CTGGCACTCGAACGCACCGAGTGCCAG

Gene: SGR_4993: Heat shock response transcriptional regulator HrcA, HrcA family
*
Streptomyces scabiei 87.22

Site:
position = -16
score = 7.2284
sequence = TTGGCACTCGCCCGGGGTGAGTGCCAA

Gene: SCAB_61551: Heat shock response transcriptional regulator HrcA, HrcA family
Heat shock response transcriptional regulator HrcA, HrcA family
dnaJ
 
Streptomyces avermitilis MA-4680

Gene: SAV_5570: Chaperone protein DnaJ
 
Streptomyces coelicolor A3(2)

Gene: SCO2554: Chaperone protein DnaJ
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_4994: Chaperone protein DnaJ
 
Streptomyces scabiei 87.22

Gene: SCAB_61561: Chaperone protein DnaJ
Chaperone protein DnaJ
 
CRON 4.
groS
*
Streptomyces avermitilis MA-4680

Site:
position = -124
score = 7.02692
sequence = CTGGCACTCCCCACTGGAGAGTGCCAG

Site:
position = -171
score = 6.60019
sequence = TTGGCACTCCGCTTGACCGAGTGCTAA

Gene: SAV_4991: Heat shock protein 60 family co-chaperone GroES
*
Streptomyces coelicolor A3(2)

Site:
position = -173
score = 6.60019
sequence = TTGGCACTCCGCTTGACCGAGTGCTAA

Site:
position = -126
score = 7.06128
sequence = CTGGCACTCCCCACTGGAGAGTGCCAA

Gene: SCO4761: Heat shock protein 60 family co-chaperone GroES
*
Streptomyces griseus subsp. griseus NBRC 13350

Site:
position = -183
score = 6.60019
sequence = TTGGCACTCCGCTTGACCGAGTGCTAA

Site:
position = -136
score = 7.0976
sequence = CTGGCACTCCCCCCTGGAGAGTGCCAG

Gene: SGR_2770: Heat shock protein 60 family co-chaperone GroES
*
Streptomyces scabiei 87.22

Site:
position = -125
score = 7.13196
sequence = CTGGCACTCCCCCCTGGAGAGTGCCAA

Site:
position = -172
score = 6.09931
sequence = TTAGCAGTCCGCTTGACCGAGTGCTAA

Gene: SCAB_36301: Heat shock protein 60 family co-chaperone GroES
Heat shock protein 60 family co-chaperone GroES
groL
 
Streptomyces avermitilis MA-4680

Gene: SAV_4992: Heat shock protein 60 family chaperone GroEL
 
Streptomyces coelicolor A3(2)

Gene: SCO4762: Heat shock protein 60 family chaperone GroEL
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_2769: Heat shock protein 60 family chaperone GroEL
 
Streptomyces scabiei 87.22

Gene: SCAB_36291: Heat shock protein 60 family chaperone GroEL
Heat shock protein 60 family chaperone GroEL
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD