Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HrcA - Nocardiaceae

Properties
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 19 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Nocardia farcinica IFM 10152 5 4
Rhodococcus erythropolis PR4 5 4
Rhodococcus opacus B4 4 3
Rhodococcus sp. RHA1 5 4
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
hsp18
*
Nocardia farcinica IFM 10152

Site:
position = -85
score = 6.65666
sequence = TTAGCACTCTACCCCGAAGAGTGCTAA

Gene: nfa8400: Small heat shock protein 18
*
Rhodococcus erythropolis PR4

Site:
position = -81
score = 6.61526
sequence = CTGGCACTCAAGGTTGCAGAGTGCCAG

Gene: RER_12450: Small heat shock protein 18
 
Rhodococcus opacus B4
*
Rhodococcus sp. RHA1

Site:
position = -101
score = 6.76842
sequence = CTGGCACTCTCGGGTGCCGAGTGCTAA

Gene: RHA1_ro06632: Small heat shock protein 18
Small heat shock protein 18
 
CRON 2.
COG2331
*
Nocardia farcinica IFM 10152

Site:
position = -52
score = 6.74829
sequence = TTGGCACTGTCGGCGGTAGAGTGCTAG

Gene: nfa49550: conserved hypothetical protein
*
Rhodococcus erythropolis PR4

Site:
position = -81
score = 6.67589
sequence = TTGGCACTGTCACTTGTAGAGTGCTAA

Gene: RER_43910: conserved hypothetical protein
*
Rhodococcus opacus B4

Site:
position = -63
score = 6.82998
sequence = TTGGCACTGTCGGCTGTAGAGTGCTAA

Gene: ROP_56950: conserved hypothetical protein
*
Rhodococcus sp. RHA1

Site:
position = -64
score = 6.88816
sequence = TTGGCACTGTCGACTGTAGAGTGCTAA

Gene: RHA1_ro05630: conserved hypothetical protein
conserved hypothetical protein
 
CRON 3.
groL2
*
Nocardia farcinica IFM 10152

Site:
position = -166
score = 7.00459
sequence = TTGGCACTCTCGACCTGTGAGTGCCAG

Site:
position = -201
score = 6.31019
sequence = CTTGCACTCGCCACCCCCGAGTGCTAG

Gene: nfa52750: Heat shock protein 60 family chaperone GroEL
*
Rhodococcus erythropolis PR4

Site:
position = -265
score = 6.32887
sequence = CTTGCACTCGGCACGCTCGAGTGCTAA

Site:
position = -230
score = 6.80729
sequence = TTGGCACTCGCGAACCGTGAGTGCCAG

Gene: RER_15260: Heat shock protein 60 family chaperone GroEL
*
Rhodococcus opacus B4

Site:
position = -200
score = 6.34001
sequence = CTTGCACTCACCCTGTTCGAGTGCTAA

Site:
position = -165
score = 6.93
sequence = TTGGCACTCGCCGCGGGTGAGTGCCAG

Gene: ROP_18630: Heat shock protein 60 family chaperone GroEL
*
Rhodococcus sp. RHA1

Site:
position = -165
score = 6.9839
sequence = TTGGCACTCACGACGCGTGAGTGCCAG

Site:
position = -200
score = 6.21372
sequence = CTTGCACTCACCCTGTCCGAGTGCTAA

Gene: RHA1_ro02146: Heat shock protein 60 family chaperone GroEL
Heat shock protein 60 family chaperone GroEL
 
CRON 4.
groS
*
Nocardia farcinica IFM 10152

Site:
position = -223
score = 6.59533
sequence = CTGGCACTCTCGTGTATAGAGTGCTAG

Gene: nfa8860: Heat shock protein 60 family co-chaperone GroES
*
Rhodococcus erythropolis PR4

Site:
position = -151
score = 7.01365
sequence = TTGGCACTCTCACGTATAGAGTGCCAA

Gene: RER_19230: Heat shock protein 60 family co-chaperone GroES
*
Rhodococcus opacus B4

Site:
position = -150
score = 7.01365
sequence = TTGGCACTCTCACGTATAGAGTGCCAA

Gene: ROP_62490: Heat shock protein 60 family co-chaperone GroES
*
Rhodococcus sp. RHA1

Site:
position = -150
score = 7.01365
sequence = TTGGCACTCTCACGTATAGAGTGCCAA

Gene: RHA1_ro06189: Heat shock protein 60 family co-chaperone GroES
Heat shock protein 60 family co-chaperone GroES
groL
 
Nocardia farcinica IFM 10152

Gene: nfa8870: Heat shock protein 60 family chaperone GroEL
 
Rhodococcus erythropolis PR4

Gene: RER_19240: Heat shock protein 60 family chaperone GroEL
 
Rhodococcus opacus B4

Gene: ROP_62500: Heat shock protein 60 family chaperone GroEL
 
Rhodococcus sp. RHA1

Gene: RHA1_ro06190: Heat shock protein 60 family chaperone GroEL
Heat shock protein 60 family chaperone GroEL
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD