Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HrcA - Mycobacteriaceae

Properties
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 40 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Mycobacterium abscessus ATCC 19977 4 3
Mycobacterium avium 104 4 3
Mycobacterium flavescens PYR-GCK 5 4
Mycobacterium leprae TN 4 3
Mycobacterium marinum M 4 3
Mycobacterium smegmatis str. MC2 155 5 4
Mycobacterium sp. JLS 5 4
Mycobacterium tuberculosis H37Rv 4 3
Mycobacterium vanbaalenii PYR-1 5 4
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
COG2331
*
Mycobacterium abscessus ATCC 19977

Site:
position = -63
score = 6.63899
sequence = CTAGCACTCCAAGCGGTAGAGTGCTAG

Gene: MAB_1084c: Conserved hypothetical protein
*
Mycobacterium avium 104

Site:
position = -55
score = 6.84268
sequence = CTAGCACTTGACACGCTAGAGTGCTAA

Gene: MAV_1100: Conserved hypothetical protein
*
Mycobacterium flavescens PYR-GCK

Site:
position = -53
score = 6.77549
sequence = CTAGCACTTGAGCCGCTAGAGTGCTAA

Gene: Mflv_1895: Conserved hypothetical protein
*
Mycobacterium leprae TN

Site:
position = -54
score = 6.55582
sequence = CTAGCACTTGGCACGGTAGAGTGCCAG

Gene: ML0180: Conserved hypothetical protein
*
Mycobacterium marinum M

Site:
position = -55
score = 6.74941
sequence = CTAGCACTTGAAACGGTAGAGTGCTAA

Gene: MMAR_4523: Conserved hypothetical protein
*
Mycobacterium smegmatis str. MC2 155

Site:
position = -55
score = 6.70683
sequence = CTAGCACTTGAGGCGGTAGAGTGCTAA

Gene: MSMEG_5479: Conserved hypothetical protein
*
Mycobacterium sp. JLS

Site:
position = -53
score = 6.81106
sequence = CTAGCACTTGAGCCGGTAGAGTGCTAA

Gene: Mjls_4670: Conserved hypothetical protein
*
Mycobacterium tuberculosis H37Rv

Site:
position = -54
score = 6.84268
sequence = CTAGCACTTGAGACGGTAGAGTGCTAA

Gene: Rv0991c: Conserved hypothetical protein
*
Mycobacterium vanbaalenii PYR-1

Site:
position = -54
score = 6.84663
sequence = CTAGCACTTGACCCGGTAGAGTGCTAA

Gene: Mvan_4835: Conserved hypothetical protein
Conserved hypothetical protein
 
CRON 2.
hsp18
 
Mycobacterium abscessus ATCC 19977
 
Mycobacterium avium 104
*
Mycobacterium flavescens PYR-GCK

Site:
position = -99
score = 6.81735
sequence = CTGGCACTCTCCTATCTCGAGTGCTAA

Gene: Mflv_1805: Small heat shock protein 18
 
Mycobacterium leprae TN
 
Mycobacterium marinum M
*
Mycobacterium smegmatis str. MC2 155

Site:
position = -97
score = 6.9295
sequence = CTAGCACTCTCACATCTCGAGTGCTAA

Gene: MSMEG_5611: Small heat shock protein 18
*
Mycobacterium sp. JLS

Site:
position = -99
score = 7.0232
sequence = CTAGCACTCGCATGTGTCGAGTGCTAA

Gene: Mjls_4761: Small heat shock protein 18
 
Mycobacterium tuberculosis H37Rv
*
Mycobacterium vanbaalenii PYR-1

Site:
position = -99
score = 6.71377
sequence = CTGGCACTCTCACAGCTCGAGTGCTAA

Gene: Mvan_4943: Small heat shock protein 18
Small heat shock protein 18
 
CRON 3.
groS
*
Mycobacterium abscessus ATCC 19977

Site:
position = -162
score = 6.91802
sequence = CTAGCACTCTCATGTATAGAGTGCTAG

Gene: MAB_3732c: Heat shock protein 60 family co-chaperone GroES
*
Mycobacterium avium 104

Site:
position = -160
score = 6.95812
sequence = CTAGCACTCGCATGTATAGAGTGCTAG

Gene: MAV_4366: Heat shock protein 60 family co-chaperone GroES
*
Mycobacterium flavescens PYR-GCK

Site:
position = -133
score = 7.01129
sequence = CTAGCACTCTCGTGTATAGAGTGCTAG

Gene: Mflv_4925: Heat shock protein 60 family co-chaperone GroES
*
Mycobacterium leprae TN

Site:
position = -236
score = 7.05139
sequence = CTAGCACTCGCGTGTATAGAGTGCTAG

Gene: ML0380: Heat shock protein 60 family co-chaperone GroES
*
Mycobacterium marinum M

Site:
position = -233
score = 6.91802
sequence = CTAGCACTCTCATGTATAGAGTGCTAG

Gene: MMAR_1125: Heat shock protein 60 family co-chaperone GroES
*
Mycobacterium smegmatis str. MC2 155

Site:
position = -159
score = 6.91802
sequence = CTAGCACTCTCATGTATAGAGTGCTAG

Gene: MSMEG_1582: Heat shock protein 60 family co-chaperone GroES
*
Mycobacterium sp. JLS

Site:
position = -86
score = 6.95812
sequence = CTAGCACTCGCATGTATAGAGTGCTAG

Gene: Mjls_1180: Heat shock protein 60 family co-chaperone GroES
*
Mycobacterium tuberculosis H37Rv

Site:
position = -199
score = 6.91802
sequence = CTAGCACTCTCATGTATAGAGTGCTAG

Gene: Rv3418c: Heat shock protein 60 family co-chaperone GroES
*
Mycobacterium vanbaalenii PYR-1

Site:
position = -131
score = 7.01129
sequence = CTAGCACTCTCGTGTATAGAGTGCTAG

Gene: Mvan_1494: Heat shock protein 60 family co-chaperone GroES
Heat shock protein 60 family co-chaperone GroES
groL
 
Mycobacterium abscessus ATCC 19977

Gene: MAB_3731c: Heat shock protein 60 family chaperone GroEL
 
Mycobacterium avium 104

Gene: MAV_4365: Heat shock protein 60 family chaperone GroEL
 
Mycobacterium flavescens PYR-GCK

Gene: Mflv_4924: Heat shock protein 60 family chaperone GroEL
 
Mycobacterium leprae TN

Gene: ML0381: Heat shock protein 60 family chaperone GroEL
 
Mycobacterium marinum M

Gene: MMAR_1126: Heat shock protein 60 family chaperone GroEL
 
Mycobacterium smegmatis str. MC2 155

Gene: MSMEG_1583: Heat shock protein 60 family chaperone GroEL
 
Mycobacterium sp. JLS

Gene: Mjls_1181: Heat shock protein 60 family chaperone GroEL
 
Mycobacterium tuberculosis H37Rv

Gene: Rv3417c: Heat shock protein 60 family chaperone GroEL
 
Mycobacterium vanbaalenii PYR-1

Gene: Mvan_1495: Heat shock protein 60 family chaperone GroEL
Heat shock protein 60 family chaperone GroEL
 
CRON 4.
groL2
*
Mycobacterium abscessus ATCC 19977

Site:
position = -131
score = 6.54916
sequence = TTGGCACTCACGACCGGTGAGTGCTAG

Site:
position = -166
score = 6.6848
sequence = CTTGCACTCGCCATGGCCGAGTGCTAA

Gene: MAB_0650: Heat shock protein 60 family chaperone GroEL
*
Mycobacterium avium 104

Site:
position = -177
score = 6.6848
sequence = CTTGCACTCGGCATGGGCGAGTGCTAA

Site:
position = -143
score = 6.61943
sequence = TTGGCACTCGCGACCAGTGAGTGCTAG

Gene: MAV_4707: Heat shock protein 60 family chaperone GroEL
*
Mycobacterium flavescens PYR-GCK

Site:
position = -174
score = 6.87589
sequence = CTTGCACTCGCCCTGGTCGAGTGCTAA

Site:
position = -139
score = 6.61943
sequence = TTGGCACTCGCGACCAGTGAGTGCTAG

Gene: Mflv_0141: Heat shock protein 60 family chaperone GroEL
*
Mycobacterium leprae TN

Site:
position = -161
score = 6.62445
sequence = CTGGCACTCGCGATCAGCGAGTGCCAG

Site:
position = -196
score = 6.45946
sequence = CTTGCACTCGCCTTAGGGGAGTGCTAA

Gene: ML0317: Heat shock protein 60 family chaperone GroEL
*
Mycobacterium marinum M

Site:
position = -175
score = 6.87288
sequence = TTGGCACTCGCGACCCGCGAGTGCTAG

Site:
position = -210
score = 6.85063
sequence = CTTGCACTCGACATAGGCGAGTGCTAA

Gene: MMAR_0759: Heat shock protein 60 family chaperone GroEL
*
Mycobacterium smegmatis str. MC2 155

Site:
position = -141
score = 6.71407
sequence = TTGGCACTCTCGATTCGTGAGTGCTAG

Site:
position = -176
score = 6.46959
sequence = CTTGCACTCACCATGCCCGAGTGCTAA

Gene: MSMEG_0880: Heat shock protein 60 family chaperone GroEL
*
Mycobacterium sp. JLS

Site:
position = -141
score = 6.81319
sequence = CTGGCACTCGCGACCGGTGAGTGCTAG

Site:
position = -176
score = 6.83579
sequence = CTTGCACTCTCCCTGGTCGAGTGCTAA

Gene: Mjls_0598: Heat shock protein 60 family chaperone GroEL
*
Mycobacterium tuberculosis H37Rv

Site:
position = -219
score = 6.62792
sequence = CTTGCACTCGGCATAGGCGAGTGCTAA

Site:
position = -184
score = 6.7288
sequence = TTGGCACTCGCGACCGGTGAGTGCTAG

Gene: Rv0440: Heat shock protein 60 family chaperone GroEL
*
Mycobacterium vanbaalenii PYR-1

Site:
position = -175
score = 6.87589
sequence = CTTGCACTCGCCCAGGTCGAGTGCTAA

Site:
position = -140
score = 6.61943
sequence = TTGGCACTCGCGACCAGTGAGTGCTAG

Gene: Mvan_0764: Heat shock protein 60 family chaperone GroEL
Heat shock protein 60 family chaperone GroEL
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD