Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HrcA - Micrococcineae

Properties
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 66 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Arthrobacter sp. FB24 7 4
Arthrobacter aurescens TC1 4 3
Arthrobacter chlorophenolicus A6 7 4
Beutenbergia cavernae DSM 12333 5 4
Brachybacterium faecium DSM 4810 6 3
Brevibacterium linens BL2 3 2
Clavibacter michiganensis subsp. michiganensis NCPPB 382 6 4
Janibacter sp. HTCC2649 6 3
Jonesia denitrificans DSM 20603 6 4
Kocuria rhizophila DC2201 7 4
Kytococcus sedentarius DSM 20547 6 3
Leifsonia xyli subsp. xyli str. CTCB07 7 5
Renibacterium salmoninarum ATCC 33209 6 3
Tropheryma whipplei str. Twist
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
hsp18
 
Arthrobacter sp. FB24
 
Arthrobacter aurescens TC1
 
Arthrobacter chlorophenolicus A6
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2

Gene: BlinB01003008: Small heat shock protein 18
*
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Site:
position = -97
score = 6.64098
sequence = TTGGCACTCCCCTGCGTCGAGTGCTAA

Gene: CMM_2092: Small heat shock protein 18
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
*
Kocuria rhizophila DC2201

Site:
position = -117
score = 6.30544
sequence = TTGGCACTCTGCTGGACCGAGTGCTAT

Gene: KRH_22230: Small heat shock protein 18
 
Kytococcus sedentarius DSM 20547
*2
Leifsonia xyli subsp. xyli str. CTCB07

Site:
position = -91
score = 6.96307
sequence = TTAGCACTCTCCATGGGTGAGTGCTAA

Gene: Lxx07755: Small heat shock protein 18

Site:
position = -91
score = 6.96307
sequence = TTAGCACTCTCCATGGGTGAGTGCTAA

Gene: Lxx22708: Small heat shock protein 18
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Small heat shock protein 18
 
CRON 2.
COG2331
*
Arthrobacter sp. FB24

Site:
position = -112
score = 6.40122
sequence = TTAGCACTCAGGCCCTGCGACTGCTAA

Gene: Arth_2866: Conserved hypothetical protein
*
Arthrobacter aurescens TC1

Site:
position = -87
score = 6.35264
sequence = TTGGCACTCAGGCCCTGCGACTGCTAA

Gene: AAur_2854: Conserved hypothetical protein
*
Arthrobacter chlorophenolicus A6

Site:
position = -90
score = 6.40122
sequence = TTAGCACTCAGGCCCTGCGACTGCTAA

Gene: Achl_2573: Conserved hypothetical protein
*
Beutenbergia cavernae DSM 12333

Site:
position = -64
score = 5.9172
sequence = TTGGCACTCGGTAGTGACAAGTGCTAG

Gene: Bcav_0902: Conserved hypothetical protein
 
Brachybacterium faecium DSM 4810

Gene: Bfae_13090: Conserved hypothetical protein
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Gene: CMM_2448: Conserved hypothetical protein
 
Janibacter sp. HTCC2649

Gene: JNB_16878: Conserved hypothetical protein
*
Jonesia denitrificans DSM 20603

Site:
position = -77
score = 5.94984
sequence = TTAGCACTCAGAAGATGAGAGTGCTGG

Gene: Jden_1970: Conserved hypothetical protein
 2
Kocuria rhizophila DC2201

Gene: KRH_06860: Conserved hypothetical protein

Gene: KRH_22990: Conserved hypothetical protein
 
Kytococcus sedentarius DSM 20547

Gene: Ksed_23900: Conserved hypothetical protein
 
Leifsonia xyli subsp. xyli str. CTCB07

Gene: Lxx05895: Conserved hypothetical protein
 
Renibacterium salmoninarum ATCC 33209

Gene: RSal33209_1752: Conserved hypothetical protein
 
Tropheryma whipplei str. Twist
Conserved hypothetical protein
 
CRON 3.
hrcA
*
Arthrobacter sp. FB24

Site:
position = -95
score = 6.25461
sequence = TTAGCACTTAGACATGTCGAGTGCTAA

Gene: Arth_2236: Heat shock response transcriptional regulator HrcA, HrcA family
 
Arthrobacter aurescens TC1

Gene: AAur_2235: Heat shock response transcriptional regulator HrcA, HrcA family
*
Arthrobacter chlorophenolicus A6

Site:
position = -110
score = 6.24363
sequence = TTAGCACTTAGGCATGTCGAGTGCTAA

Gene: Achl_1973: Heat shock response transcriptional regulator HrcA, HrcA family
*
Beutenbergia cavernae DSM 12333

Site:
position = -47
score = 6.40594
sequence = TTGGCACTCGGCCCGGGTGAGTGCTGG

Gene: Bcav_1748: Heat shock response transcriptional regulator HrcA, HrcA family
*
Brachybacterium faecium DSM 4810

Site:
position = -98
score = 5.98638
sequence = TTGGCACCTGGCACGGCAGAGTGCCAG

Gene: Bfae_17300: Heat shock response transcriptional regulator HrcA, HrcA family
 
Brevibacterium linens BL2

Gene: BlinB01000188: Heat shock response transcriptional regulator HrcA, HrcA family
*
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Site:
position = -39
score = 5.86703
sequence = TTGGCAGTCAGAACCGACGAGTGCCAG

Gene: CMM_1564: Heat shock response transcriptional regulator HrcA, HrcA family
*
Janibacter sp. HTCC2649

Site:
position = -48
score = 6.24417
sequence = TTGGCACTCACCAAGCATGAGTGCCAG

Gene: JNB_05025: Heat shock response transcriptional regulator HrcA, HrcA family
*
Jonesia denitrificans DSM 20603

Site:
position = -50
score = 6.62301
sequence = TTGGCACTCGGCAGTGGGGAGTGCCAA

Gene: Jden_1550: Heat shock response transcriptional regulator HrcA, HrcA family
*
Kocuria rhizophila DC2201

Site:
position = -90
score = 6.08158
sequence = TTAGCACTGTGCGCGGATGAGTGCCAA

Gene: KRH_13010: Heat shock response transcriptional regulator HrcA, HrcA family
*
Kytococcus sedentarius DSM 20547

Site:
position = -75
score = 5.87878
sequence = CTGGCACTTGACGTCCCCGAGTGCCAG

Gene: Ksed_11690: Heat shock response transcriptional regulator HrcA, HrcA family
*
Leifsonia xyli subsp. xyli str. CTCB07

Site:
position = -49
score = 6.48651
sequence = TTGGCACTCAGGATCAGCGAGTGCTAA

Gene: Lxx14650: Heat shock response transcriptional regulator HrcA, HrcA family
*
Renibacterium salmoninarum ATCC 33209

Site:
position = -233
score = 6.53907
sequence = TTAGCACTTGGGCAAGCCGAGTGCTAA

Gene: RSal33209_1927: Heat shock response transcriptional regulator HrcA, HrcA family
 
Tropheryma whipplei str. Twist
Heat shock response transcriptional regulator HrcA, HrcA family
dnaJ
 
Arthrobacter sp. FB24

Gene: Arth_2235: Chaperone protein DnaJ
 
Arthrobacter aurescens TC1

Gene: AAur_2234: Chaperone protein DnaJ
 
Arthrobacter chlorophenolicus A6

Gene: Achl_1972: Chaperone protein DnaJ
 
Beutenbergia cavernae DSM 12333

Gene: Bcav_1749: Chaperone protein DnaJ
 
Brachybacterium faecium DSM 4810

Gene: Bfae_17290: Chaperone protein DnaJ
 
Brevibacterium linens BL2

Gene: BlinB01000187: Chaperone protein DnaJ
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Gene: CMM_1565: Chaperone protein DnaJ
 
Janibacter sp. HTCC2649

Gene: JNB_05020: Chaperone protein DnaJ
 
Jonesia denitrificans DSM 20603

Gene: Jden_1549: Chaperone protein DnaJ
 
Kocuria rhizophila DC2201

Gene: KRH_13000: Chaperone protein DnaJ
 
Kytococcus sedentarius DSM 20547

Gene: Ksed_11700: Chaperone protein DnaJ
 
Leifsonia xyli subsp. xyli str. CTCB07

Gene: Lxx14640: Chaperone protein DnaJ
 
Renibacterium salmoninarum ATCC 33209

Gene: RSal33209_1926: Chaperone protein DnaJ
 
Tropheryma whipplei str. Twist
Chaperone protein DnaJ
rsmE
 
Arthrobacter sp. FB24

Gene: Arth_2234: 16S ribosomal RNA methyltransferase
 
Arthrobacter aurescens TC1

Gene: AAur_2233: 16S ribosomal RNA methyltransferase
 
Arthrobacter chlorophenolicus A6

Gene: Achl_1971: 16S ribosomal RNA methyltransferase
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810

Gene: Bfae_17280: 16S ribosomal RNA methyltransferase
 
Brevibacterium linens BL2

Gene: BlinB01000186: 16S ribosomal RNA methyltransferase
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Gene: CMM_1566: 16S ribosomal RNA methyltransferase
 
Janibacter sp. HTCC2649

Gene: JNB_05015: 16S ribosomal RNA methyltransferase
 
Jonesia denitrificans DSM 20603

Gene: Jden_1548: 16S ribosomal RNA methyltransferase
 
Kocuria rhizophila DC2201

Gene: KRH_12990: 16S ribosomal RNA methyltransferase
 
Kytococcus sedentarius DSM 20547

Gene: Ksed_11710: 16S ribosomal RNA methyltransferase
 
Leifsonia xyli subsp. xyli str. CTCB07

Gene: Lxx14630: 16S ribosomal RNA methyltransferase
 
Renibacterium salmoninarum ATCC 33209

Gene: RSal33209_1925: 16S ribosomal RNA methyltransferase
 
Tropheryma whipplei str. Twist
16S ribosomal RNA methyltransferase
 
CRON 4.
groL2
*
Arthrobacter sp. FB24

Site:
position = -244
score = 6.66381
sequence = CTTGCACTCTCCCCGGGGGAGTGCTAA

Site:
position = -209
score = 6.31988
sequence = TTAGCACTCCCACGGACTGACTGCTAA

Gene: Arth_0779: Heat shock protein 60 family chaperone GroEL
*
Arthrobacter aurescens TC1

Site:
position = -245
score = 6.63936
sequence = CTTGCACTCTCCCCGGTCGAGTGCTAA

Site:
position = -210
score = 5.96981
sequence = TTAGCACTCCTATGGTTCGACTGCTAA

Gene: AAur_1001: Heat shock protein 60 family chaperone GroEL
*
Arthrobacter chlorophenolicus A6

Site:
position = -204
score = 6.34222
sequence = TTAGCACTCTGACGTACCGACTGCTAA

Site:
position = -239
score = 6.54296
sequence = CTTGCACTCTCACCGGGGGAGTGCTAA

Gene: Achl_0894: Heat shock protein 60 family chaperone GroEL
*
Beutenbergia cavernae DSM 12333

Site:
position = -177
score = 6.47859
sequence = CTTGCACTCGCAGGAGGAGAGTGCCAA

Site:
position = -143
score = 6.35018
sequence = TTAGCACTCTCACCACGAGAGTGACAA

Gene: Bcav_0821: Heat shock protein 60 family chaperone GroEL
*
Brachybacterium faecium DSM 4810

Site:
position = -246
score = 6.27048
sequence = TTAGCACTCTCCGCCGTCGAGTGCTTA

Site:
position = -212
score = 5.5793
sequence = CTGGCACTCGTGGATCGAGAGTGACAG

Gene: Bfae_07610: Heat shock protein 60 family chaperone GroEL
*
Brevibacterium linens BL2

Site:
position = -184
score = 6.78526
sequence = TTTGCACTCGCATGGGGAGAGTGCTAA

Gene: BlinB01000562: Heat shock protein 60 family chaperone GroEL
*
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Site:
position = -71
score = 6.29897
sequence = CTGGCACTCCCTCACGGGGAGTGCTAG

Site:
position = -106
score = 6.29597
sequence = CTTGCACTCCCGTAGGGCGAGTGCCAG

Gene: CMM_2478: Heat shock protein 60 family chaperone GroEL
*
Janibacter sp. HTCC2649

Site:
position = -155
score = 6.35096
sequence = TTGGCACTCTCCTTAAAGGAGTGCCAA

Site:
position = -189
score = 6.5077
sequence = TTTGCACTCTCCACCCGAGAGTGCCAA

Gene: JNB_16609: Heat shock protein 60 family chaperone GroEL
*
Jonesia denitrificans DSM 20603

Site:
position = -180
score = 6.47072
sequence = CTTGCACTCTCCATGCGAGAGTGCCAA

Site:
position = -146
score = 6.40248
sequence = TTGGCACTCTCGCATGGAGAGTGATAA

Gene: Jden_2055: Heat shock protein 60 family chaperone GroEL
*
Kocuria rhizophila DC2201

Site:
position = -176
score = 6.16191
sequence = TTAGCACTCAGTCGAGTGGACTGCTAA

Gene: KRH_18370: Heat shock protein 60 family chaperone GroEL
*
Kytococcus sedentarius DSM 20547

Site:
position = -217
score = 6.07478
sequence = TTGGCACTCGGCGGCTCCGAGTGACAG

Gene: Ksed_21770: Heat shock protein 60 family chaperone GroEL
*
Leifsonia xyli subsp. xyli str. CTCB07

Site:
position = -70
score = 6.63486
sequence = TTAGCACTCCGCCTTACCGAGTGCTAA

Site:
position = -104
score = 5.91792
sequence = CTTGCACTCCACCGCGACGAGTGCCAG

Gene: Lxx18010: Heat shock protein 60 family chaperone GroEL
*
Renibacterium salmoninarum ATCC 33209

Site:
position = -206
score = 6.28506
sequence = CTTGCACTCTCACCCTTCGAGTGCTAA

Site:
position = -171
score = 6.46146
sequence = TTAGCACTCTCCCGTTCTGACTGCTAA

Gene: RSal33209_0482: Heat shock protein 60 family chaperone GroEL
 
Tropheryma whipplei str. Twist

Gene: TW441: Heat shock protein 60 family chaperone GroEL
Heat shock protein 60 family chaperone GroEL
 
CRON 5.
groS
*
Arthrobacter sp. FB24

Site:
position = -185
score = 6.75516
sequence = CTGGCACTCGCCTTGACCGAGTGCTAA

Site:
position = -138
score = 6.75128
sequence = TTAGCACTCTCCCTAGGAGGGTGCTAA

Gene: Arth_2887: Heat shock protein 60 family co-chaperone GroES
*
Arthrobacter aurescens TC1

Site:
position = -122
score = 6.72155
sequence = TTAGCACTCTCCCCCGGAGGGTGCTAA

Site:
position = -167
score = 6.64992
sequence = CTGGCACTCACCTTGACCGAGTGCTAA

Gene: AAur_2875: Heat shock protein 60 family co-chaperone GroES
*
Arthrobacter chlorophenolicus A6

Site:
position = -136
score = 6.75536
sequence = TTAGCACTCTCCCGAGGAGGGTGCTAA

Site:
position = -182
score = 6.75516
sequence = CTGGCACTCGCCTTGACCGAGTGCTAA

Gene: Achl_2595: Heat shock protein 60 family co-chaperone GroES
*
Beutenbergia cavernae DSM 12333

Site:
position = -180
score = 6.90065
sequence = TTGGCACTCGCCTTGACCGAGTGCTAA

Gene: Bcav_3058: Heat shock protein 60 family co-chaperone GroES
*
Brachybacterium faecium DSM 4810

Site:
position = -132
score = 6.10539
sequence = TTGGCAGTCGACGGCCGAGAGTGCCAG

Site:
position = -182
score = 6.33062
sequence = TTAGCACTCGTGTTGCGTGAGTGCCAG

Gene: Bfae_08630: Heat shock protein 60 family co-chaperone GroES
*
Brevibacterium linens BL2

Site:
position = -182
score = 6.56878
sequence = TTGGCACTCGAGTTGACCGAGTGCTAA

Site:
position = -137
score = 6.05631
sequence = TTAGCACTAGCACTCAGTGAGTGCCAG

Gene: BlinB01001687: Heat shock protein 60 family co-chaperone GroES
*
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Site:
position = -65
score = 6.38642
sequence = CTGGCACTCTCCTCGGGAGATTGCCAA

Site:
position = -112
score = 6.48522
sequence = TTGGCACTCGCGTTGCGCGAGTGCAAG

Gene: CMM_2568: Heat shock protein 60 family co-chaperone GroES
*
Janibacter sp. HTCC2649

Site:
position = -137
score = 6.78376
sequence = TTGGCACTCGCCCTGTGTGAGTGCCAG

Site:
position = -185
score = 6.56878
sequence = TTGGCACTCGAGTTGACCGAGTGCTAA

Gene: JNB_17483: Heat shock protein 60 family co-chaperone GroES
*
Jonesia denitrificans DSM 20603

Site:
position = -146
score = 6.90065
sequence = TTGGCACTCGCCTTGACCGAGTGCTAA

Gene: Jden_0635: Heat shock protein 60 family co-chaperone GroES
*
Kocuria rhizophila DC2201

Site:
position = -158
score = 6.83007
sequence = TTAGCACTCTCCCAGGGAGGGTGCTAA

Gene: KRH_06750: Heat shock protein 60 family co-chaperone GroES
*
Kytococcus sedentarius DSM 20547

Site:
position = -183
score = 6.22922
sequence = CTGGCACTCGAGTTGACCGAGTGCCAG

Site:
position = -136
score = 6.0645
sequence = TTGGCACTCAGCGTCGTCGGGTGCCAG

Gene: Ksed_07560: Heat shock protein 60 family co-chaperone GroES
*
Leifsonia xyli subsp. xyli str. CTCB07

Site:
position = -59
score = 5.968
sequence = TTAGCACTCTCATCATGAGGTTGCTAA

Site:
position = -106
score = 5.98626
sequence = TTGGCACTTACGTTGCGTGACTGCTAA

Gene: Lxx19880: Heat shock protein 60 family co-chaperone GroES
*
Renibacterium salmoninarum ATCC 33209

Site:
position = -177
score = 6.79542
sequence = TTGGCACTCACCTTGACCGAGTGCTAA

Site:
position = -130
score = 6.386
sequence = TTAGCACTCTCGTACTGAGGGTGCTAA

Gene: RSal33209_1769: Heat shock protein 60 family co-chaperone GroES
 
Tropheryma whipplei str. Twist

Gene: TW074: Heat shock protein 60 family co-chaperone GroES
Heat shock protein 60 family co-chaperone GroES
groL
 
Arthrobacter sp. FB24

Gene: Arth_2886: Heat shock protein 60 family chaperone GroEL
 
Arthrobacter aurescens TC1

Gene: AAur_2874: Heat shock protein 60 family chaperone GroEL
 
Arthrobacter chlorophenolicus A6

Gene: Achl_2594: Heat shock protein 60 family chaperone GroEL
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810

Gene: Bfae_08640: Heat shock protein 60 family chaperone GroEL
 
Brevibacterium linens BL2

Gene: BlinB01001686: Heat shock protein 60 family chaperone GroEL
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649

Gene: JNB_17488: Heat shock protein 60 family chaperone GroEL
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201

Gene: KRH_06760: Heat shock protein 60 family chaperone GroEL
 
Kytococcus sedentarius DSM 20547

Gene: Ksed_07570: Heat shock protein 60 family chaperone GroEL
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209

Gene: RSal33209_1768: Heat shock protein 60 family chaperone GroEL
 
Tropheryma whipplei str. Twist
Heat shock protein 60 family chaperone GroEL
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD