Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HrcA - Alcaligenaceae

Properties
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bordetella avium 197N 3 2
Bordetella bronchiseptica RB50 3 2
Bordetella petrii DSM 12804 3 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
rpoH
*
Bordetella avium 197N

Site:
position = -37
score = 7.167
sequence = TTAGCACTCAACCATTTGGAGTGCTAA

Gene: BAV3285: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
*
Bordetella bronchiseptica RB50

Site:
position = -36
score = 7.43946
sequence = TTAGCACTCGATTGCGTGGAGTGCTAA

Gene: BB4835: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
*
Bordetella petrii DSM 12804

Site:
position = -72
score = 7.11397
sequence = TTAGCACTCGCACATAGAGAGTGCTAA

Gene: Bpet0159: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
 
CRON 2.
groS
*
Bordetella avium 197N

Site:
position = -85
score = 7.87453
sequence = TTAGCACTCGTCGCCGGTGAGTGCTAA

Gene: BAV0580: Heat shock protein 60 family co-chaperone GroES
*
Bordetella bronchiseptica RB50

Site:
position = -91
score = 7.87453
sequence = TTAGCACTCGTCGCCGGTGAGTGCTAA

Gene: BB0963: Heat shock protein 60 family co-chaperone GroES
*
Bordetella petrii DSM 12804

Site:
position = -90
score = 7.90512
sequence = TTAGCACTCGCTGCCGGTGAGTGCTAA

Gene: Bpet3931: Heat shock protein 60 family co-chaperone GroES
Heat shock protein 60 family co-chaperone GroES
groL
 
Bordetella avium 197N

Gene: BAV0579: Heat shock protein 60 family chaperone GroEL
 
Bordetella bronchiseptica RB50

Gene: BB0962: Heat shock protein 60 family chaperone GroEL
 
Bordetella petrii DSM 12804

Gene: Bpet3932: Heat shock protein 60 family chaperone GroEL
Heat shock protein 60 family chaperone GroEL
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD