Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HrcA - Frankineae/Propionibacterineae/Pseudonocardiaceae

Properties
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 47 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Frankia sp. EAN1pec 9 6
Frankia sp. CcI3 7 4
Nakamurella multipartita DSM 44233 8 5
Acidothermus cellulolyticus 11B 8 5
Nocardioides sp. JS614 7 4
Propionibacterium acnes KPA171202 6 3
Actinosynnema mirum DSM 43827 4 3
Saccharomonospora viridis DSM 43017 4 3
Saccharopolyspora erythraea NRRL 2338 3 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
groS
*
Frankia sp. EAN1pec

Site:
position = -105
score = 6.9424
sequence = TTGGCACTCGGCACTTGAGAGTGCCAG

Gene: Franean1_6002: Heat shock protein 60 family co-chaperone GroES
*
Frankia sp. CcI3

Site:
position = -108
score = 6.98317
sequence = TTGGCACTCGGCACGTGAGAGTGCCAG

Gene: Francci3_0632: Heat shock protein 60 family co-chaperone GroES
*
Nakamurella multipartita DSM 44233

Site:
position = -156
score = 6.46639
sequence = CTGGCACTCCCATGGCTAGAGTGCTAG

Gene: Namu_1207: Heat shock protein 60 family co-chaperone GroES
*
Acidothermus cellulolyticus 11B

Site:
position = -179
score = 6.38499
sequence = CTGGCACTCTCCTTGACGGAGTGCTAA

Site:
position = -133
score = 6.54198
sequence = CTGGCACTCTCGACCCGAGGGTGCCAA

Gene: Acel_0362: Heat shock protein 60 family co-chaperone GroES
*
Nocardioides sp. JS614

Site:
position = -168
score = 6.51093
sequence = CTGGCACTCAGTTGGCGAGAGTGCTAG

Site:
position = -133
score = 6.75924
sequence = TTGGCACTCTCCACCGGAGTGTGCCAG

Gene: Noca_3647: Heat shock protein 60 family co-chaperone GroES
*
Propionibacterium acnes KPA171202

Site:
position = -132
score = 6.48037
sequence = TTGGCACTCTCGTGGTGAGTGTGCCAA

Site:
position = -179
score = 6.38365
sequence = CTGGCACTCCCGTTGCCTGAGTGCCAA

Gene: PPA1773: Heat shock protein 60 family co-chaperone GroES
*
Actinosynnema mirum DSM 43827

Site:
position = -128
score = 6.70716
sequence = TTGGCACTCGAATGGGTAGAGTGCTAG

Gene: Amir_6544: Heat shock protein 60 family co-chaperone GroES
*
Saccharomonospora viridis DSM 43017

Site:
position = -133
score = 6.58716
sequence = CTAGCACTCAGCTGGCTAGAGTGCTAA

Gene: Svir_04660: Heat shock protein 60 family co-chaperone GroES
*
Saccharopolyspora erythraea NRRL 2338

Site:
position = -131
score = 6.83053
sequence = CTGGCACTCGCGTGGGTAGAGTGCTAG

Gene: SACE_6715: Heat shock protein 60 family co-chaperone GroES
Heat shock protein 60 family co-chaperone GroES
groL
 
Frankia sp. EAN1pec

Gene: Franean1_6001: Heat shock protein 60 family chaperone GroEL
 
Frankia sp. CcI3

Gene: Francci3_0633: Heat shock protein 60 family chaperone GroEL
 
Nakamurella multipartita DSM 44233

Gene: Namu_1208: Heat shock protein 60 family chaperone GroEL
 
Acidothermus cellulolyticus 11B

Gene: Acel_0363: Heat shock protein 60 family chaperone GroEL
 
Nocardioides sp. JS614

Gene: Noca_3646: Heat shock protein 60 family chaperone GroEL
 
Propionibacterium acnes KPA171202

Gene: PPA1772: Heat shock protein 60 family chaperone GroEL
 
Actinosynnema mirum DSM 43827

Gene: Amir_6543: Heat shock protein 60 family chaperone GroEL
 
Saccharomonospora viridis DSM 43017

Gene: Svir_04670: Heat shock protein 60 family chaperone GroEL
 
Saccharopolyspora erythraea NRRL 2338

Gene: SACE_6714: Heat shock protein 60 family chaperone GroEL
Heat shock protein 60 family chaperone GroEL
 
CRON 2.
groL2
*3
Frankia sp. EAN1pec

Site:
position = -188
score = 6.61602
sequence = CTTGCACTCACCCATGCCGAGTGCTAA

Site:
position = -154
score = 6.80049
sequence = TTGGCACTCTCCCCATGGGAGTGCCAA

Gene: Franean1_0175: Heat shock protein 60 family chaperone GroEL

Site:
position = -139
score = 6.86381
sequence = TTAGCACTCGACAGGGTTGAGTGCCAA

Gene: Franean1_3854: Heat shock protein 60 family chaperone GroEL

Site:
position = -140
score = 6.71087
sequence = CTGGCACTCAGCTAGGTCGAGTGCCAA

Gene: Franean1_3353: Heat shock protein 60 family chaperone GroEL
*2
Frankia sp. CcI3

Site:
position = -168
score = 6.66771
sequence = CTGGCACTCTCGCCTAGGGAGTGCCAA

Site:
position = -202
score = 6.65679
sequence = CTTGCACTCACCCAGGCCGAGTGCTAA

Gene: Francci3_4398: Heat shock protein 60 family chaperone GroEL

Gene: Francci3_2175: Heat shock protein 60 family chaperone GroEL
*
Nakamurella multipartita DSM 44233

Site:
position = -192
score = 6.31984
sequence = TTGGCACTCGGAACCAACGAGTGCCAG

Site:
position = -226
score = 6.84435
sequence = CTTGCACTCTCCGCGGTCGAGTGCTAA

Gene: Namu_4827: Heat shock protein 60 family chaperone GroEL
*
Acidothermus cellulolyticus 11B

Site:
position = -179
score = 6.4876
sequence = CTTGCACTCTCGACCCTTGAGTGCTAA

Site:
position = -144
score = 6.21885
sequence = CTAGCACTCCACATCGGAGAGTGACAA

Gene: Acel_0101: Heat shock protein 60 family chaperone GroEL
*
Nocardioides sp. JS614

Site:
position = -195
score = 6.69179
sequence = CTTGCACTCTCAGGGGTCGAGTGCTAA

Site:
position = -160
score = 6.7962
sequence = CTGGCACTCTCCCCCGGAGAGTGACAA

Gene: Noca_3982: Heat shock protein 60 family chaperone GroEL
*
Propionibacterium acnes KPA171202

Site:
position = -195
score = 6.46705
sequence = TTGGCACTCGACAAGCGAGAGTGCTAC

Site:
position = -230
score = 6.48173
sequence = TTTGCACTCGCTGGGTGTGAGTGCTAA

Gene: PPA0453: Heat shock protein 60 family chaperone GroEL
*
Actinosynnema mirum DSM 43827

Site:
position = -178
score = 6.88671
sequence = CTGGCACTCGGCACTGCTGAGTGCCAG

Site:
position = -213
score = 6.79657
sequence = CTTGCACTCTCGGGTGGCGAGTGCTAA

Gene: Amir_0442: Heat shock protein 60 family chaperone GroEL
*
Saccharomonospora viridis DSM 43017

Site:
position = -168
score = 6.91385
sequence = TTGGCACTCGGCACCGTCGAGTGCTAG

Site:
position = -203
score = 6.64086
sequence = CTTGCACTCTCACCCTGAGAGTGCTAA

Gene: Svir_34390: Heat shock protein 60 family chaperone GroEL
*
Saccharopolyspora erythraea NRRL 2338

Site:
position = -180
score = 6.76932
sequence = CTGGCACTCAGCAAGGTCGAGTGCCAG

Site:
position = -215
score = 6.83734
sequence = CTTGCACTCGCCACGCGAGAGTGCTAA

Gene: SACE_0527: Heat shock protein 60 family chaperone GroEL
Heat shock protein 60 family chaperone GroEL
 
CRON 3.
hrcA
*
Frankia sp. EAN1pec

Site:
position = -152
score = 6.92838
sequence = TTGGCACTCACGGCGGCCGAGTGCCAG

Gene: Franean1_2109: Heat shock response transcriptional regulator HrcA, HrcA family
*
Frankia sp. CcI3

Site:
position = -95
score = 6.82404
sequence = TTGGCACTCACTGCGGCCGAGTGCCAA

Gene: Francci3_1264: Heat shock response transcriptional regulator HrcA, HrcA family
*
Nakamurella multipartita DSM 44233

Site:
position = -57
score = 6.1037
sequence = TTGGCAGCCGGAGCGGGCGAGTGCCAA

Gene: Namu_1571: Heat shock response transcriptional regulator HrcA, HrcA family
*
Acidothermus cellulolyticus 11B

Site:
position = -78
score = 6.6421
sequence = CTGGCACTCGACAACCCTGAGTGCCAA

Gene: Acel_0783: Heat shock response transcriptional regulator HrcA, HrcA family
*
Nocardioides sp. JS614

Site:
position = -73
score = 6.63343
sequence = TTGGCACTCAGGACTTTCGAGTGCCAG

Gene: Noca_1903: Heat shock response transcriptional regulator HrcA, HrcA family
*
Propionibacterium acnes KPA171202

Site:
position = -67
score = 6.66393
sequence = GTGGCACTCGGCACCCGAGAGTGCCAA

Gene: PPA0915: Heat shock response transcriptional regulator HrcA, HrcA family
 
Actinosynnema mirum DSM 43827

Gene: Amir_1241: Heat shock response transcriptional regulator HrcA, HrcA family
 
Saccharomonospora viridis DSM 43017

Gene: Svir_13540: Heat shock response transcriptional regulator HrcA, HrcA family
 
Saccharopolyspora erythraea NRRL 2338

Gene: SACE_1479: Heat shock response transcriptional regulator HrcA, HrcA family
Heat shock response transcriptional regulator HrcA, HrcA family
dnaJ
 
Frankia sp. EAN1pec

Gene: Franean1_2110: Chaperone protein DnaJ
 
Frankia sp. CcI3

Gene: Francci3_1265: Chaperone protein DnaJ
 
Nakamurella multipartita DSM 44233

Gene: Namu_1572: Chaperone protein DnaJ
 
Acidothermus cellulolyticus 11B

Gene: Acel_0784: Chaperone protein DnaJ
 
Nocardioides sp. JS614

Gene: Noca_1904: Chaperone protein DnaJ
 
Propionibacterium acnes KPA171202

Gene: PPA0916: Chaperone protein DnaJ
 
Actinosynnema mirum DSM 43827

Gene: Amir_1242: Chaperone protein DnaJ
 
Saccharomonospora viridis DSM 43017

Gene: Svir_13550: Chaperone protein DnaJ
 
Saccharopolyspora erythraea NRRL 2338

Gene: SACE_1480: Chaperone protein DnaJ
Chaperone protein DnaJ
rsmE
 
Frankia sp. EAN1pec

Gene: Franean1_2111: 16S ribosomal RNA methyltransferase
 
Frankia sp. CcI3

Gene: Francci3_1266: 16S ribosomal RNA methyltransferase
 
Nakamurella multipartita DSM 44233

Gene: Namu_1573: 16S ribosomal RNA methyltransferase
 
Acidothermus cellulolyticus 11B

Gene: Acel_0785: 16S ribosomal RNA methyltransferase
 
Nocardioides sp. JS614

Gene: Noca_1905: 16S ribosomal RNA methyltransferase
 
Propionibacterium acnes KPA171202

Gene: PPA0917: 16S ribosomal RNA methyltransferase
 
Actinosynnema mirum DSM 43827

Gene: Amir_1243: 16S ribosomal RNA methyltransferase
 
Saccharomonospora viridis DSM 43017

Gene: Svir_13560: 16S ribosomal RNA methyltransferase
 
Saccharopolyspora erythraea NRRL 2338

Gene: SACE_1481: 16S ribosomal RNA methyltransferase
16S ribosomal RNA methyltransferase
 
CRON 4.
COG2331
*
Frankia sp. EAN1pec

Site:
position = -42
score = 5.56926
sequence = TTGGCAGTCCTTACCACCGAGTGCCAA

Gene: Franean1_0686: Conserved hypothetical protein
*
Frankia sp. CcI3

Site:
position = -42
score = 6.52678
sequence = TTGGCAGTCTCCACGTCAGAGTGCCAA

Gene: Francci3_4042: Conserved hypothetical protein
*
Nakamurella multipartita DSM 44233

Site:
position = -61
score = 6.43399
sequence = CTGGCACTGGGCACTGTCGAGTGCCAA

Gene: Namu_4645: Conserved hypothetical protein
*
Acidothermus cellulolyticus 11B

Site:
position = -37
score = 5.91134
sequence = TTAGCAATCGAAGCTACCGAGTGCTAA

Gene: Acel_0161: Conserved hypothetical protein
*
Nocardioides sp. JS614

Site:
position = -76
score = 6.74832
sequence = TTGGCACTCGTCAGGGCCGAGTGCCAG

Gene: Noca_0787: Conserved hypothetical protein
 
Propionibacterium acnes KPA171202

Gene: PPA2407: Conserved hypothetical protein
*
Actinosynnema mirum DSM 43827

Site:
position = -50
score = 6.38508
sequence = TTGGCACTCGTGACGTGGGAGTGCCAA

Gene: Amir_0626: Conserved hypothetical protein
*
Saccharomonospora viridis DSM 43017

Site:
position = -72
score = 6.57679
sequence = TTAGCACTCTCGGCAATCGAGTGCCAG

Gene: Svir_32690: Conserved hypothetical protein
 
Saccharopolyspora erythraea NRRL 2338
Conserved hypothetical protein
 
CRON 5.
hsp18
 
Frankia sp. EAN1pec
 
Frankia sp. CcI3
*
Nakamurella multipartita DSM 44233

Site:
position = -98
score = 6.77087
sequence = TTGGCACTCTCGGTCGTCGAGTGCTAA

Gene: Namu_0179: Small heat shock protein 18
*2
Acidothermus cellulolyticus 11B

Gene: Acel_0160: Small heat shock protein 18

Site:
position = -54
score = 6.59921
sequence = CTAGCACTCGACAGCACCGAGTGCTAA

Gene: Acel_0609: Small heat shock protein 18
 
Nocardioides sp. JS614
 
Propionibacterium acnes KPA171202

Gene: PPA0737: Small heat shock protein 18
 
Actinosynnema mirum DSM 43827
 
Saccharomonospora viridis DSM 43017
 
Saccharopolyspora erythraea NRRL 2338

Gene: SACE_3659: Small heat shock protein 18
Small heat shock protein 18
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD